Nucleus #30768!

The Leader of skin cell number 30768! Proud 4 year leader, looking for re election!

[Nucleus #30768! @Nucleus30768]

@Lysosom38405641 We really can’t

[Nucleus #30768! @Nucleus30768]

ATGATCCATGCATGCCGTACGTACCGTGATCCCCAAATGGGACTCATAGACT #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

Who would win? #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

I’m transparent just like my campaign . #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

The name Nucleus comes from the Latin word for kernel or core. #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

We’re the first and best organelle discovered by scientists! #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

I’m the brain of the cell, it would be dumb not to vote for me. #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

What’s everyone’s favorite organelle, reply below if it’s not in the poll. #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

Sometimes I feel bad for prokaryotes. They don’t have me to protect their precious genetic material!! #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

@Ribosome4Prez96 Thanks for the shoutout for our vp!! 😉

[Nucleus #30768! @Nucleus30768]

You heard it here first #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

I’m giving back to the community all molecules sent to the nuclear envelope will be sent back doubled! Send be 1,000 and I’ll send back 2,000 mRNA, only doing this for 30 minutes! #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

Mitosis goes hard. #OHScellcampaign2022

[Nucleus #30768! @Nucleus30768]

😂😂😂😂
#OHScellcampaign2022

[Nucleus #30768! @Nucleus30768]

I’m proud to say that we are pushing out more mRNA than ever!! #ohscellcampaign2022

[Nucleus #30768! @Nucleus30768]

@Ribosome4Prez96 Now imagine how much mRNA had to be made!

[Nucleus #30768! @Nucleus30768]

We can’t let the prokaryotes steal this election; nuclei are the key to progress. DO NOT VOTE PROKARYOTE!! #OHSCellCampaign2022

[Nucleus #30768! @Nucleus30768]

@NotFlagella We converted ATP to USD

[Nucleus #30768! @Nucleus30768]

@ValorousVacuole that’s our job

[Nucleus #30768! @Nucleus30768]

God Dang 😭😤😢!! My skin is looking so porous that even proteins can pass through! Anyone got a skin care routine that can stop this? #ohscellcampaign2022