Our molecular data encoded into Blockchain can trace beer authenticity! Hack by @AmbrosusAMB team at @OpendataCH - #foodfraud#AMLD2018 https://t.co/nCthOsUA7N
A new very nice study entitled "Characteristics of bacterial and yeast #microbiomes in spontaneous and and mixed-fermentation #beer and #cider" https://t.co/5p27bRMVMw
it's great to see our #beerdecoded data-set compared and reanalysed.
A blend-athon! Our dedicated partners @SwissDeCode are going all-in to prepare a maximum of foods for sequencing: 2 days straight blending foods to prepare a 96-set of food samples for #DNA sequencing with @nanopore MinIon🔎🤓🧬. Go team💪
Find out more https://t.co/wZ42715ep1
Found in fish fingers. Can you ID?🤓 🧬🐟CGACTGTTTTACCAAAAACATCACCTCTTGCTCAAATATAAGAATTTGCCTGCCCTGTGACTATAAGTTTAACGGCCGCGGTATTTTAACCGTGCGAAGGTAGCGTAATCACTTTGATAAATGAAGACCTGTATGAATGGCATCACGAGGGCTTAGCTGTCTCCCATCTCCAGTCAATGAGGTGACACTCCCGTCTGAGGCAGGGGATAATTACATAAGACAGAGAGAAGACCCTGTGG
Our 1st food DNA workshop was a success! Featured now on @EPFL homepage - read all about it👇and see some pics. Many thanks to the participants, who made it such a fun and productive day @hackuarium https://t.co/nHTyPGlUkK #CitizenScience#FoodTransparency Opinion from @frc_CH
.@nanopore + Beer: Today we pour Beer into the MinION's pores! Sequencing yeast extracted from Beer with Nanopore. Together with wonderful Blackforest-Backstreet citizen-science team: @NothSteph @bjoerngruening@bebatut@tesamueller @Spike_Black_Sun @MCFoell@couac
If you're in Lausanne Area join us at the @hackuarium TONIGHT 7 PM to talk about GMOs and to test the GMO Detective kit. Bring your food to test and register here 👉 https://t.co/fUJYjdKZcG #openscience#biohack
Want to test if there are GMOs in your food? Hackuarium will be hosting the GMO detective workshop on june 1rst 2018, Further information and registration at: https://t.co/Y5T671fOJw
@mario_micnuel @AmbrosusAMB @OpendataCH Concept: The QR code is based on biochemical fingerprints measured on each product batch. Authenticity can be verified by QR scans or by portable sensors like the ones of @swissdecode