adey desta

Environmental Biotechnologist, Janitor of the Earth´s aquatic system

[adey desta @destadey]

Tremor sensed while in the office

[adey desta @destadey]

https://t.co/45H68HaMor

[International Water Association @IWAHQ]

🌍"Financing Water Solutions for Climate Resilience" a keynote by @SarojJha001 from @WorldBank at the #WorldWaterCongress & Exhibition in #Toronto mentioned how he's deeply impressed by the quality of dialogue and dedication to tackling #WaterChallenges taking place in the event!

[adey desta @destadey]

https://t.co/xfF86L8E2U

[International Water Association @IWAHQ]

The wait is over! Paul Brown’s keynote “Resilience in Practice: Avoiding Planning Traps” at the #WorldWaterCongress has just begun at the Main Hall (Level 800)! With over 40 years of experience in project planning and programme management, his insights are invaluable.

[adey desta @destadey]

Day 2 of #WorldWaterCongress The importance of adaptive capacity to resilient water and wastewater treatment systems!

[International Water Association @IWAHQ]

Day 2 of the #WorldWaterCongress & Exhibition kicks off! Stop by the registration stand to get your badge and explore today's exciting sessions. Don’t miss the upcoming keynote by Paul Brown starting shortly. Get ready for another day of innovation and inspiration!

[adey desta @destadey]

@IWAHQ @PeterGleick Inspiring message on the recurring issues of water and the need to proactivity.

[International Water Association @IWAHQ]

Thrilled to have the River Christie-White Dance Troupe light up the stage at the #WorldWaterCongress & Exhibition! Their powerful performance beautifully captured the spirit of #water, unity, and #resilience.

[International Water Association @IWAHQ]

It’s a full house at the opening ceremony of the #WorldWaterCongress & Exhibition in #Toronto! An incredible turnout as we come together to address global water challenges and shape a sustainable future.

[International Water Association @IWAHQ]

Peter Van, Congress President, highlighted at the #WorldWaterCongress & Exhibition: “I want to take a moment to recognize the young water professionals @ywp here. This global event is where progress is made and learning flourishes.” 🌍💧 #WaterFuture #YoungWaterProfessionals

[International Water Association @IWAHQ]

Congratulations to Helle Katrine Andersen for being awarded the Outstanding Service Award at the #WorldWaterCongress and Exhibition in #Toronto! Her impressive contributions to IWA include her leadership in the Danish National IWA Committee and her key role in the 2022 Congress.

[adey desta @destadey]

May 13, 14 - 15 SAST, Genomics for Health in Africa by Dr. Eduan Wilkinson on pathogen genomic surveillance in Africa and beyond and Dr. med. Joohyun Park on the association of heterozygous UCHL1 variants and neurodegeneration. https://t.co/xrt3fmsCcP

[Mariamawit Y Yeshak @YMariamawit]

Honoring Prof Shibiru Tedla, a legend indeed. 'Bigger than life' according to Prof Masresha's words. @HoheAwards @AddisAbabaUnive @BDR_Photography @biniamhirut

[IWAPublishing @IWAPublishing]

🔓 Read Biological Wastewater Treatment for FREE as an #OpenAccess eBook!
➡ https://t.co/njexPtHexa

IWA Publishing's bestseller is available to download now as a free-to-read eBook.

#Wastewater #Biology #WastewaterTreatment #FreetoRead #Water #WaterResearch @MarkvLoosdrecht

[Nebiyat Nigusie Woldeyohannis (PhD) @NWoldeyohannis]

#ARG #mobilomes #struvite #human urine #reclamation
Our work which found out ARGs and mobilomes on human urine derived struvite was published. If you find it important below is the link: https://t.co/nuFYcDy26b

[Tulio de Oliveira @Tuliodna]

Another 1st author from original data generators in Africa @Abusis27 Dr. Abey Sisay, Addis Ababa University, lead an African team in this publication! Dr. Sisay is one of our fellows leading scientific research in Ethiopia & Africa!
Open manuscript: https://t.co/motbi81OlH

[Addis Fortune @addis_fortune]

Running water shortage in the capital has fully grown adults going to their parents' houses to get cleaned up. The scarcity is felt intensely in the condominiums and apartments as the low power makes it impossible to proceed beyond the first floors.

[Happy Researchers @hapyresearchers]

The manuscript

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at @ensembl