Quan Duong

Graduate student @UChicago, interested in developing biochemical tools to solve biological problems at the molecular level.

[Mind Dynamo @MindDynamo]

Goal setting worksheet (save for later)

[Nature Reviews Bioengineering @natrevbioeng]

Genetically targeted chemical assembly uses cell-specific genetic information to guide the assembly of functional materials in situ. This article discusses how this concept can be applied for fundamental research and the treatment of diseases: https://t.co/mSOTe5vQSq

[nature @Nature]

Taking omega-3 and vitamin D supplements over a three-year period slowed biological ageing by three to four months, particularly when combined with exercise.

https://t.co/YlxZmaqoXX

[Quan Duong @QuanChemist]

@phmailan Do bà bị ume đó

[Oded Rechavi @OdedRechavi]

Oxford nanopore sequencing

[Quan Duong @QuanChemist]

@phmailan Chắc chắn sẽ được

[Quan Duong @QuanChemist]

Finally, it’s out!

[Google DeepMind @GoogleDeepMind]

Announcing AlphaFold 3: our state-of-the-art AI model for predicting the structure and interactions of all life’s molecules. 🧬

Here’s how we built it with @IsomorphicLabs and what it means for biology. 🧵 https://t.co/gjw6Ip4F2M

[Quan Duong @QuanChemist]

@aphicho Lol. Lesson learned!

[Twist Bioscience @TwistBioscience]

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

[Jonathan Yang @Jony_theChemist]

Glad to see our work on Genetically Encoded LYTACs (GELYTACs) in @PNASNews. Highlights include directed evolution of GELYTACs & secretion of GELYTACs by primary T-cells. Special thanks to @aliceyting @CarolynBertozzi, and collaborators @mackalllab. https://t.co/Yqf05BFebu

[Quan Duong @QuanChemist]

@aphicho The flame looks like a green alien 👽👽👽

[C&EN (Chemical & Engineering News) @cenmag]

.@CarolynBertozzi is a scientific celebrity. But as a young chemist, Bertozzi struggled to make her way into the field. C&EN follows how the culture of chemistry has changed throughout Bertozzi’s career—and how she, in turn, has changed the culture. https://t.co/6Bg5GGsHQT

[Itai Yanai @ItaiYanai]

How did we lose our tail? A simple question.. but it wasn't really asked before! We discovered a plausible scenario for the genetic mechanism that led to tail loss. Amazing that such a big change may have been caused by such a small genetic event. https://t.co/0ZR8aH23PJ @BoXia7

[Kiran Musunuru @kiranmusunuru]

The culmination of 10+ years of work to use #CRISPR gene editing to fight heart disease!

@ambellinger @VerveTx $VERV presenting the interim data from the ongoing heart-1 Phase 1b clinical trial of VERVE-101 base editing for HeFH patients, at #AHA23 now.

Let’s start!

🧵

[Tim Green @tfgg2]

New! We’ve just put up a note evaluating the latest, in-development version of AlphaFold (“AlphaFold-latest”). This is a preview - development is still in progress - but performance across a wide range of tasks is striking.

https://t.co/28nuVOir9v

Highlights in the thread.

1/7

[UChicago Chemistry @UChiChemistry]

We welcome the largest incoming graduate class ever to our program! Welcome to #Chemistry!

[Choose Chicago @ChooseChicago]

Hyde Park was just named one of the coolest neighborhoods in the world by Time Out, and we agree! 😎 It landed at #19 on a list of 40, and ranked 4th coolest of the neighborhoods in the U.S.

🔗 See how to spend 24 hours in Hyde Park: https://t.co/LjPp4igCBL

📸: @BarryButler9

[Quan Duong @QuanChemist]

I have a chance to listen to his lecture about this project. It’s really mind-blowing 🤯🤯🤯

[Quan Duong @QuanChemist]

Interestingly, Click chemistry (Nobel Prize 2022) was also employed in the directed evolution (Nobel Prize 2018).

[Quan Duong @QuanChemist]

#journal_club This paper incorporated a range of biochemical techniques: directed evolution, optogenetics, synthetic chemistry, and structural biology to edit phospholipids in membrane. https://t.co/Bli7hQRibK

[Quan Duong @QuanChemist]

Through this paper, we can learn a range of techniques and how the authors leverage them to solve the problems.