Solomon Chak

Assistant Professor
Biology
Denison University

[Solomon Chak @solomonchak]

No small task. Assistant biology professor Solomon Chak brought a collection of 40,000 shrimp specimens and some very big questions about evolution - Denison Magazine.
https://t.co/HJoVXJpuq9

[Solomon Chak @solomonchak]

A summer of discovery for Denison Students. https://t.co/9KQ7PQjQ3I

[Solomon Chak @solomonchak]

Eusocial shrimps @Evol_mtg 2024

[Solomon Chak @solomonchak]

@DenisonU students spent ~ a week in the Dominican Republic to collect sponge-dwelling shrimps!

#NSFfunded #Research @DenisonU

[Solomon Chak @solomonchak]

Eusocial snapping shrimps in Ircinia sp. in the Dominican Republic. Locals call this sponge the guanabana!
#NSFfunded #Research @DenisonU

[Solomon Chak @solomonchak]

Live sponges and shrimps arrive at the lab!
@DenisonU

[Solomon Chak @solomonchak]

We spent hours digging through sponges for shrimps in the "wet" lab. And - YES we found eusocial shrimps!
It's likely the first documentation of eusocial species in Puerto Rican reefs!

#NSF #Research @DenisonU

[Solomon Chak @solomonchak]

What lies beneath these Puerto Rican reefs?

The Chak Lab is exploring the diversity and origins of #eusociality in Synalpheus snapping shrimps.

Supported by #NSFfunded and in collaboration with the Barden Lab @Haidomyrmex.

[Solomon Chak @solomonchak]

To find out, we dove at various sites up to 75 feet deep to look for sponges known to host Synalpheus shrimps. Thanks to #dive buddy and long-term collaborator Dr. Kristin Hultgren @seattleu. Great pics by @uw_explorer

#Research @DenisonU

[MacAdemics @MacAdemics_Ed]

Gene expression control by enhancers. Nice analogy by @DougVer here https://t.co/l97IS2YHsg

[Nicolás Mongiardino Koch @phyloprog]

If you ever wondered how much universities pay assistant professors, and how that compares to the local cost of living, wonder no more..

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at
@ensembl

[Dr. Easton White @eastonrwhite]

List of eco/evo/marine labs recruiting for Fall 2024: https://t.co/i3eO2zJPIk

Link to form for PIs to fill out: https://t.co/49siUzE1iv

[🇺🇦 🇨🇴 🇺🇸 Andrew J. Crawford @CrawfordAJ]

Could you get a nice genome assembly from a sample left out at room temp. for 1.5 months?
Yes!
🐠🩸 stored in 95% EtOH at 22°C for 6 weeks yielded 14 Mb N50 & 97% BUSCO from 34X coverage @nanopore sequencing [with short fragment eliminator (SFE) kit].

https://t.co/LyGhyX0WL5

[The Crustacean Society @CrustaceanSoci]

Super cool start to Day 3 of #ICC10 with Alan Jamieson @Hadalbloke, sharing about observations of hadal crustaceans along 16 trenches and adjoining abyssal plains, highlighting key species and inter-species interactions 🦐, including the supergiant amphipod Alicella gigantea

[The Crustacean Society @CrustaceanSoci]

New book alert 📷: Shrimps: Their Diversity, Intriguing Adaptations and Varied Lifestyles (By Ray T Bauer) explores the biology of decapod shrimps , a group of animals known to most people as a nutritious and tasty food item.

Get the book here: https://t.co/oroId7TXmO

[Solomon Chak @solomonchak]

Congratulations to Areej Nawaz for getting the 3rd place award at the 2023 STEP conference!

She presented a poster on the morphometric and sexual system of snapping shrimps.

[STEPOldWestbury @STEPOldWestbury]

Areej Nawaz, 3rd place award, Abeni Tucker, 1st place poster, 2023 STEP conference. #stepcnf23, ⁦@WestburyWHS⁩, ⁦@onewestbury⁩, ⁦@WestburySTEAM⁩, ⁦@SUNYOldWestbury⁩, ⁦@ApacsOrg⁩ , ⁦@NYSEDNews⁩, ⁦⁦@UniondaleSciRes⁩ ⁦@Freeport_HS⁩

[Dustin Rubenstein @DustRubenstein]

Our new method for affordably studying DNA methylation using hybridization capture finally in print. I hope people find it useful.
https://t.co/XAmwOBUh0u

[Solomon Chak @solomonchak]

👏@SUNYOldWestbury students presented their projects at the Metropolitan Association of College and University Biologists (MACUB) Conference (Nov 2022)

Thiago Figueiredo - Fruit fly gene annotation.
Prashanti Kodali - Comparative Genomics Class Project.

[Solomon Chak @solomonchak]

Our campus is gorgeous now @SUNYOldWestbury