Richard Cassidy

PhD Candidate studying #epigenetics 🧬 | @FondufeYvonne Lab @VAInstitute | also bagpipes

[Richard Cassidy @Biology_Richard]

@arkajit_de @SpringerNature 🔥

[Peyman Milanfar @docmilanfar]

seeing your novel idea in an old paper

[Sarah Bodbyl Roels @scheetah]

Are you a graduate student using epigenomic and metabolomic methods in your thesis research? #Apply for the VAI Epigenomics Workshop, Sept. 19–21. This is an excellent #free #opportunity to sharpen your #research skills and #network in your field. https://t.co/Fu2zlRPZHT

[Richard Cassidy @Biology_Richard]

@FondufeYvonne Thanks to a great mentor!! Couldn't have done it without your support!

[Kansas City Chiefs @Chiefs]

SUPER BOWL LVII CHAMPIONS!!!

[Stephanie Grainger @sgraingerPhD]

Happy to chat via https://t.co/pvTguvUR1X to any folks interested in the @VAInstitute graduate school!

[Van Andel Institute (VAI) @VAInstitute]

The application period is now open for our 2023 Summer Internship Programs! Gain hands-on research experience, learn from leading professionals and pave the way for a rewarding career in biomedical sciences. Apply now: https://t.co/TMrZjXjnQg

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at @ensembl

[Elon Musk @elonmusk]

Should I step down as head of Twitter? I will abide by the results of this poll.

[Peter W. Laird (@peterwlaird.bsky.social) @peterwlaird]

New cellular ‘clock’ offers fresh way to measure age https://t.co/Zq4ZGqkHqH

[Peter W. Laird (@peterwlaird.bsky.social) @peterwlaird]

Our #epigenetics paper in Nature Communications is out with experimental evidence that DNA methylation loss in #aging and #cancer is caused by cell division. Congrats to @JamieEndicott, Paula Nolte, @shenhui1986 and @VAInstitute! https://t.co/Fr8Zd5e4qx

[Richard Cassidy @Biology_Richard]

@lmk9990 #staystrong

[Richard Cassidy @Biology_Richard]

Recent paper from the @FondufeYvonne lab :)
~also first publication for me!~

Great appreciation to Smitha George, an excellent postdoc and mentor!

@VAInstitute #ScienceTwitter #epigenetics

https://t.co/PjW8GvTJ7Q

[THINK Academia @THINKAcademia]

Monday reminder 🌻

You may have more than a dozen tasks lined up for this week. But you don't have to complete them all now or even today. Prioritize your task list and "pace yourself so you don’t crash mid-week."

#AcademicMentalHealth @PhDVoice @OpenAcademics #AcademicChatter

[Oded Rechavi @OdedRechavi]

Untenured PIs saving all their results for one big paper

[Moved on to @parafilmm.bsky.social @ParafilmM]

Money doesn't grow on trees, but Parafilm could if the IRB would stop rejecting my proposals.

[Arkajit De (he/him/his) @arkajit_de]

Real (Left) vs Illustrated (Right) fluorescence microscopic view of human lung fibroblast cell
Real Image credit: https://t.co/6WlS9NYZcI

Illustrated by @Photoshop
#FluorescenceFriday #sciart

[Richard Cassidy @Biology_Richard]

@PhDVoice what are your thoughts on the acceptance changes over at @eLife ?

How do you think this movement might effect me as a #grad #student in #science?

[eLife Community @eLifeCommunity]

Over at @eLife, we’re eliminating accept/reject decisions and relinquishing the traditional journal role of gatekeeper.

This new model is our move towards a fairer system that helps researchers get recognition for what, not where they publish. Read more: https://t.co/XIzOyb7W1l

[Richard Cassidy @Biology_Richard]

Hey look! My thesis mentor @FondufeYvonne had a great podcast interview! It was part of a series with some other scientists @VAInstitute

Link below:

Exposed: Environmental Echoes in Health - How Toxins Leave Their Cancerous Marks https://t.co/UzUOhdYqb0