Rory Tinker

Assistant Professor & Medical Geneticist at Mount Sinai | Precision Medicine | Rare Disease Genomics | Trying to improve life for people with genetic disease |

[Rory Tinker @ClinGenRory]

Genetic testing has gone from rare to routine. Our study traces two decades of change in how it’s used across clinical care—what’s being ordered, for whom, and why it matters. #Genomics #HealthcareInnovation https://t.co/gAdqziyvEp

[Seamus Ó Cualáin @jimfoley]

I am interested in going to a World Cup game at Gillette but not really going to pay $1000 for two tickets to Norway vs Iraq.

[Keir Starmer @Keir_Starmer]

Football should bring people together, not shut them out.

For the first time since the competition began, fans won’t be able to watch the Champions League final for free. That’s not right.

This is bigger than wanting to watch Arsenal in this historic final. It’s bigger than one club.

Hardworking people shouldn’t have to fork out for a subscription to watch this match.

I urge TNT Sports to reconsider and make the final next Saturday free to watch.

[Daniel Friedman @DanFriedman81]

I wonder what will happen in the economy if 80 million people who have reliably consumed 3500 calories of food each day for the last 30 years suddenly start eating only 1800 calories.

[David Spencer @DaveASpencer]

Where is the Rubicon here? Watford Junction? Milton Keynes Central?

[cj battey @cj_battey]

The 23&me GLP1 gwas paper is very well done (the most readable gwas paper ... ever?), but I think putting this supp table 22 result in the main text would have helped keep things in perspective

[Rory Tinker @ClinGenRory]

@NoahRyanCo The biggest differences I noticed moving from England to the US is how transactional everything feels. Everyone seems to charge the maximum, with endless middlemen (e.g. realtors) and fees. The system feels designed to rip you off, except Fidelity, which I’ve found amazing.

[Lior Pachter @lpachter]

I don't get the frustration people are venting over this.

NG have gone out of their way to ensure that me and my students are not harmed by the increasing time lag between receiving our papers to accepting them by always (100% of the time!) rejecting my papers. 🙏

[Ross Prager @ross_prager]

Physicians who sit at the bedside (compared to standing) are perceived to have spent longer with their patient and have higher patient satisfaction.

[Rory Tinker @ClinGenRory]

@heynavtoor Or you could just buy a target dated retirement fund and make a better return with less complexity.

[Jess Coleman @jesskcoleman]

Hot take: What makes NYC so beautiful in the snow is that cars (and noise) virtually disappear.

[Rory Tinker @ClinGenRory]

Pregnancy is usually safe… but risk isn’t one-size-fits-all.” Our paper links 58k+ mother–baby EHR dyads to map Mendelian condition-specific risks and build the largest dataset for personalized prenatal care. https://t.co/AOZIBttmya

[U.S. Senator Bill Cassidy, M.D. @SenBillCassidy]

As a doctor who treated patients for decades, my top priority is protecting children and families. Multiple children have died or were hospitalized from measles, and South Carolina continues to face a growing outbreak. Two children have died in my state from whooping cough. All of this was preventable with safe and effective vaccines.

The vaccine schedule IS NOT A MANDATE. It’s a recommendation giving parents the power. Changing the pediatric vaccine schedule based on no scientific input on safety risks and little transparency will cause unnecessary fear for patients and doctors, and will make America sicker.

[Rory Tinker @ClinGenRory]

@silvirouskin Is this the ESI Mira or the senior investigator version ? I am struggling with his to structure my ESI R35.

[Ensembl @ensembl]

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

[Rory Tinker @ClinGenRory]

Our new paper (led by Yutaka Furata) shows CHD8-associated IDDAM can be inherited, not just de novo. Genome sequencing, EpiSign, and structural modeling enabled reclassification of a CHD8 VUS as pathogenic.
https://t.co/megK9NXck0
#RareDisease #Genomics #CHD8 #EpiSign

[Samuel Hume @DrSamuelBHume]

This is genuinely paradigm-shifting

1-3% of patients diagnosed with (relatively) common diseases – atopic dermatitis, inflammatory bowel disease, and multiple sclerosis – actually have much rarer monogenic conditions, revealed by genome sequencing

Given the obvious importance of a correct diagnosis, and the diminishing cost and time of genome sequencing, maybe it's time to move it to the frontline

[Rory Tinker @ClinGenRory]

New cohort study led by Cathy Shyr with our UDN team shows GPT-4o correctly suggested the final diagnosis in 13.3% of undiagnosed rare disease cases and gave a helpful differential in 23.3%. A promising step for LLMs in rare disease dx. #RareDisease

https://t.co/HGIxh8ejCF

[Rory Tinker @ClinGenRory]

In our new paper, we solved a decades-long diagnostic mystery.
Exome: no answer.
Genome: no answer.
PacBio HiFi revealed a giant MARCHF6 repeat expansion causing FAME3, with mosaicism seen at single-read resolution.
https://t.co/h32C8LmDMf
#FAME3 #Neurogenetics

[Rory Tinker @ClinGenRory]

New from our team in AJO: The eye is a powerful window into undiagnosed genetic disease. Routine ophthalmic findings can reveal inherited conditions before systemic signs appear.
https://t.co/DQ6XQIlUIf
#EyeGenetics #RareDisease #GenomicMedicine

[Genetics in Medicine @GIMJournal]

Out with the old? #OGM outperforms #CMA by revealing structural info, aiding clinical interpretation of copy number gains. https://t.co/RbmJdCiKuk #VUS #genomicstructure