@drewendy.bsky.social

Awestronomer

[lisa brown @LisaBrownMPH]

#Smallpox #Biosecurity in a New Era of Technology | Think Global Health https://t.co/sHiU2jbSMg summarizing key findings from our recent @theNASEM report @shalsingar @BhadeliaMD @LawrenceGostin @DrewEndy https://t.co/OxCSECtyC4

[@drewendy.bsky.social @DrewEndy]

@Varro_Analytics @lynnconway Lynn & I shared a taxi to Logan once. She’d made the trip to Cambridge to help w/ the 2002/3 DARPA synthetic biology study. Her advice to me was very clear, “Go meta!” Her VLSI courses were the template for iGEM. Rip Lynn. Grateful to have known you. Thank you for teaching me.

[Tom Knight -- e/🦀🌴 @TomKnightSynBio]

Honoring Lynn Conway's passing:
https://t.co/Sq2ZrKdN5Z

[Michael Fischbach @mfgrp]

How to pick a problem. Today in @CellCellPress. 1/53
https://t.co/Id4YaXWuup

[Tom Ellis @ProfTomEllis]

Moving office is a pain but finding you still have these old conference books is worth it. Who else was at SB4.0 in Hong Kong?

[Staph papers @Staph_papers]

Genome-Wide Transcription Response of Staphylococcus epidermidis to Heat Shock and Medically Relevant Glucose Levels https://t.co/7iY7Nc2RxM

[Hoover Institution @HooverInst]

@DrewEndy called for sustained funding in fundamental engineering research. He highlighted the importance of supporting projects that may lack immediate commercial application. https://t.co/DMmYpo7M9S

[EBRC @EngBioRC]

Check out the new EBRC In Translation episode with @DrewEndy! Drew talks with @Andrew_C_Hunt and @Rana_Biotech about progress in synthetic biology, and so much more. He also introduces us to our favorite new concepts: the labrary and Awestronomy. Enjoy!

https://t.co/oGtpfdiLlL

[Mel B @melbwinning]

$DNA Thanks @DrewEndy for the weekend listening! Please produce more content!! https://t.co/rs0RXNYLXF

[Jason Kelly @jrkelly]

Fortunate to have @ARPA_HDirector and @DrewEndy join us to kick off the first meeting of 2024 of the National Security Commission on Emerging Biotech !! 🇺🇸🧬

Inspiriting for the commissioners to hear how great a biodesigned future could be and how USG could make it happen!

[Bin Shao @ShaoBin_phy]

@DrewEndy @srikosuri Current the model is available: https://t.co/eothBDhmmU. Please let me know if you have any problems running the codes!

[@drewendy.bsky.social @DrewEndy]

@srikosuri Am i missing something? Where is an example of a so-generated phage genome that i can look at?

[Ryan Morhard @RyanMorhard]

Important article today from Tara O'Toole and Sarah Sewell w/ In-Q-Tel.

"The nation that pioneers the bioengineering solutions of tomorrow will be safer, richer, and more powerful."

They're right.

https://t.co/CTiOb5xbPA

[Antheia @antheiabio]

A win for pharma supply chains: In an effort to mitigate drug shortages, today the @WhiteHouse announced its plans to leverage the Defense Production Act to onshore manufacturing of KSMs and APIs for critical, essential medicines. Read more here: https://t.co/y0LdXFhmAa

[Rosamund Lewis @PeopleDocGeneva]

Today @World Health Organization published two Disease Outbreak News items- on pneumonia in China and on #mpox in the Democratic Republic of the Congo.

https://t.co/U4mnzo3Goh

WHO is supporting these outbreak investigations.

[@drewendy.bsky.social @DrewEndy]

@ProfTomEllis @vdlorenzo_CNB taatacgactcactatagggaga?

[NIMI VASHI (bio/acc to infinity & beyond) @nimivashi15]

Priceless reaction! When a team wins @iGEM . This Indian team from @igem_iisertvm looks gorgeous adorning a global stage representing India . The future of India in Biotech! @PMOIndia

#india #biotech #iGEM #bioeconomy #iGEM2023 #startups #india

[Lambert iGEM @lamberths_iGEM]

congrats to everyone who competed at the @iGEM grand jamboree! it’s been a great season and we had so much fun learning about everyone’s projects. see you all next year 😆😆😆

[Bindu Reddy @bindureddy]

LLMs will soon become a commodity, there are already dozens of them out there and dozens more are being trained

Grok, is the latest one trained on Twitter's data and took less than a few months to train.

Soon they will be considered part of the software stack just like databases and other machine learning algorithms

They will also reach a plateau in a couple of years, when we run out of good quality data

The will be enormously useful and really good at information retrieval, Q/A and generation.

They will be tools and assistant that will do the heavy lifting and automating.

But that's it - There won't be anything super special about them and they won't be some ultimate killer machines.

The good news is there will be several applications and personal assistants offered by X, Meta, Open AI and others.

The AI Executive Order was premature and the attempt by the incumbents to ban open-source AI and stifle innovation will be unsuccessful.

[@drewendy.bsky.social @DrewEndy]

Remember how the biotech EO from late ‘22 included a mandate requiring screening all software at the compile stage in the name of computer security? Me neither…