At @plasmidsaurus, we discovered our $50, 3 day TAT RNA-seq service can also detect mycoplasma contamination from several prominent species, and we've already alerted over a hundred labs to likely contamination. We're working on adding this to the service for free very soon.
At @plasmidsaurus, we discovered our $50, 3 day TAT RNA-seq service can also detect mycoplasma contamination from several prominent species, and we've already alerted over a hundred labs to likely contamination. We're working on adding this to the service for free very soon.
Your cell line sequencing data isn’t mapping well?
Before blaming the aligner—check if you're sequencing bacteria instead of human.
Let’s talk about mycoplasma contamination.
My first podcast is out today with @markwbudde, CEO of @plasmidsaurus.
Plasmidsaurus took whole-plasmid sequencing from $600 to $15 and turned a "boring" service company idea into a hugely successful company that now serves >70,000 scientists.
We talked about what it means to build a "boring" company, whether the Plasmidsaurus idea could apply to other technologies (like CRISPR screens), and why Plasmidsaurus isn't expanding into China. This podcast is made possible by @AsteraInstitute.
00:00 – Enter Plasmidsaurus
01:21 – Reducing sequencing costs by 40x
04:17 – Scaling Oxford Nanopore technology
06:29 – Venture capital and building a "boring" company
13:03 – Plasmidsaurus vs. traditional CROs
22:25 – On selling customer data
30:10 – Building a moat
37:08 – 50-minute results
39:26 – Logistics and the UPS partnership
48:42 – The Chinese market
50:20 – Playbook for new biotech founders
52:31 – The future of biological reasoning and AI
You can find the podcast, THE NEW BIOLOGY, on YouTube, Spotify, and everywhere else.
DYK: Plasmidsaurus RNA-Seq gives you answers you can explore 🔍
One especially nifty feature: In the interactive results dashboard, you can normalize gene expression to a control (or any sample) and instantly visualize log fold changes across genes and pathways.
• Spot up/down-regulated genes in seconds
• Compare conditions without wrestling spreadsheets
• Go from raw reads to biological insight fast
No R. No Python. No bioinformatics spelunking 🕳️
Just point, click, and uncover what your genes have been hiding 🦖
🦖 Plasmidsaurus is heading to #AACR2026!
Come find us at Booth #4945 to:
🧬 Learn how Plasmidsaurus can power your cancer research, from unveiling gene expression patterns to validating tools like CRISPR constructs and tumor suppressor plasmids
🤝 Meet our founders
👕 Grab some exclusive merch
🎨 Join our dino drawing tradition
See you in San Diego 👋
What’s cooler than being cool? No dry ice.
We’ve teamed up with Genovis to develop SEQguard™ Dino Preserve, a thermostable RNA protection solution for Plasmidsaurus RNA-Seq.
Now you can ship purified RNA at room temp. No ice. No stress. Just fast, reliable RNA-seq.
Read more
https://t.co/yqet3xFpnp
Still screenshotting your RNA-Seq plots for slides? 👀
Small update, big quality-of-life upgrade.
🧬 Export your RNA-Seq analysis exactly how you need it:
• SVGs for publication-ready figures
• Clean visuals for lab meeting slides
• Raw data downloads straight from plots
Available now in your analysis!
This is an ILLEGAL war on Mordor.
We’re told Sauron “poses an existential threat,” yet somehow this involves sending hobbits 1,500 miles to a volcano.
Regime change in Mordor will only create a power vacuum filled by worse orcs.
Sauron is bad, sure. But is he “march to Mount Doom” bad?
Meanwhile second breakfast is underfunded.
Tell me again how this puts the Shire first?
Just received results from @plasmidsaurus RNA-seq. Three business days, comprehensive QC reports, a simple, normalized gene expression matrix, and an ultra intuitive UI to visually explore DEGs. $50/sample. This is the future of bulk transcriptomics!
Can't properly describe what was going on in our lab when we realized that @plasmidsaurus has 2 BD turnaround time for RNA-seq. Biotech is forever changed now.
(Their fastest competitor is at 1 month...)
We’ve seen some impressive plasmids in our time… but this one might take the cake (and the dropbox)!
Huge shoutout to Karine from the Pepin Lab at MGH for this legendary Halloween costume - a dino delivering a T-rex-sized plasmid that defies the laws of molecular biology! 🦖
Ladies if you go to his apartment and his fridge is full of sequencing primers for his plasmid collection you DO NOT date him you deserve a man who does whole plasmid sequencing
Okay time to dig in my freezer and find my 16s primers. Gonna send amplicons out to @plasmidsaurus to see if the colonies that grew on LB are our E. flagellatus tritonivores or some other critter. Grew nicely overnight in LB broth (miller mod).
No luck finding them so gonna order a fresh set. Here are the primers I use, 5'->3':
16s-27F
AGAGTTTGATCCTGGCTCAG
16s-338R
TGCTGCCTCCCGTAGGAGT
16s-1392R
GGTTACCTTGTTACGACTT
16s-longRG-FCCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG
16s-longRG-R CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT
RESULTS!!!
Okay so got 12k reads (bug seems very hard to crack) but the kind folks at @plasmidsaurus.bsky.social offered to rerun. In the meantime, I'm getting some very strong blast hits for a recently discovered species, Edaphobacter flagellatus.
FASTQ:
https://t.co/rgpfNLB01q
Got to see the amazing new @PacBio desktop long-read system. The price is nice and surprisingly the reagent price is close to its bigger sibling. #PAG32