Marcia H Beltrame

Professor and researcher on human population genetics and genomics, investigating history and health in populations of African Ancestry in Brazil. She/her

[Chris Stringer @ChrisStringer65]

5,000-Year-Old Wolves Found on Remote Island Challenge Conventional Views of Domestication https://t.co/s8v6OXlxmn

[Ensembl @ensembl]

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

[Science Magazine @ScienceMagazine]

This year researchers finally put a face to one of our long-lost relatives—confirming with DNA evidence that a 146,000-year-old skull known as the “Dragon Man” belonged to a Denisovan, an extinct lineage of humans that, like the Neanderthals, once shared the planet with modern humans.

Learn more about Science's 2025 Breakthrough of the Year and the runners-up: https://t.co/WQ8H95SIYY

[Marcia H Beltrame @marciahbeltrame]

Tracing the Uncharted African Diaspora in Southern Brazil: The Genetic Legacies of Resistance in Two Quilombos from Paraná https://t.co/cOI3dyrqCh #mdpigenes via @Genes_MDPI

[Roberto Sáez @robertosaezm]

Identificado un linaje prehistórico hasta ahora desconocido en el centro de Argentina:
Eight millennia of continuity of a previously unknown lineage in Argentina https://t.co/fH50Hgwjqa

[Chris Stringer @ChrisStringer65]

The Hidden Denisovan Gene That Helped Humans Conquer the Americas https://t.co/6ISZ7sjXVP

[Carina Schlebusch @cschlebu.bsky.social @cschlebu]

Our new ancient DNA paper has just been published! We present 28 new genomes from southern Africa - several of them high-coverage whole genomes. Exciting to be moving towards population-level representation of ancient southern African genetic diversity!

https://t.co/YqLqu6mp9H

[Marcia H Beltrame @marciahbeltrame]

Novo Comitê de Ética em Pesquisa é empossado https://t.co/tpylwsZllX via @ufrgsnoticias

[Marcia H Beltrame @marciahbeltrame]

Pesquisadores realizam coleta de dados e atendimentos na Terra Indígena Guarita - RD Foco  https://t.co/q56xesbW01

[Marcia H Beltrame @marciahbeltrame]

Just published! The Current State of Breast Cancer Genetics in Populations of African Ancestry https://t.co/OQV4nVPzrJ #mdpigenes via @Genes_MDPI

[Marcia H Beltrame @marciahbeltrame]

Seminário Aborda Sub-representatividade da População Negra em Estudos Genéticos e Impactos nas Políticas de Saúde https://t.co/OPj4zytIFd

[Marcia H Beltrame @marciahbeltrame]

@marcotrizzino Well, to be fair you are a scientist so you rock in another field!

[Penn Medicine @PennMedicine]

A new genetic study—using data from the Million Veteran program—highlights the importance of diversity in understanding health disparities. @damrauer @_anuragverma @DeptVetAffairs https://t.co/FAg9jZZDR3

[Marcia H Beltrame @marciahbeltrame]

Vagas abertas!

[European Society of Human Genetics (ESHG) @eshgsociety]

You cannot make it to #eshg2024 in Berlin this year in person? No problem - we got you covered! Benefit from our #hybridconference concept and enjoy all sessions live and on demand via our virtual platform. Register for online participation now!
https://t.co/KcEJKwLVeJ

[Marcia H Beltrame @marciahbeltrame]

The 2nd International Electronic Conference on Genes https://t.co/Uz9BCVmR2e #IECGE2024 via @sciforum

[Jonathan Pritchard @jkpritch]

I'm delighted to release the first half of my new open-access online textbook in human population genetics:
https://t.co/GHMPCTv6BL

[Marcia H Beltrame @marciahbeltrame]

A Pós-Graduação da UFRGS e a Pesquisa / Ação em Saúde em Comunidades Indígenas Kaingang no Rio Grande do Sul https://t.co/AXyMrKfRV4