Patrick G.S. Grady, Ph.D. (he/him)

T2T Comparative Genomics. Genome assembly @itiscolossal and @roneilllab, evolutionary analysis for T2T Consortia. Neurodivergent, LGBT 🏳️‍🌈, dog dad 3x 🐕🐕🐕

[Marjan Hosseini @MarjHosseini]

🚨Paper Alert🚨

I am excited to share our new paper published in Bioinformatics.

Deep statistical modelling of nanopore sequencing translocation times reveals latent non-B DNA structures https://t.co/5BEfRmurpU

@nanopore @UConn #ISMBECCB2023

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

@JillWegrzyn Thank you! 😁

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

New title just dropped ⬆️

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

😁
Huge thanks to everyone who helped me along the way

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

Dissertation IN. Two weeks to go!

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

Less than one month to dissertation defense time! Can't wait! Will be local at UConn in ESB and via Zoom on July 21st at 9:30 EST. DM for the link if you'd like to watch!

[Oxford Nanopore @nanopore]

During his talk, @patrickgsgrady discussed assembling telomere-to-telomere genomes & epigenomes across multiple marsupials. He also discussed his research into marsupial-specific centromere & repetitive element structures using nanopore sequencing: https://t.co/zuEEZ7n8po 3/4

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

@biodiversityge1 Yep you definitely said it exactly right! 😁

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

@Nemasoil Is this you telling someone they shouldn’t be posting their own free speech and dehumanizing those who live outside the gender binary? Seems a bit counterintuitive to your argument to respect all viewpoints.

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

4 weeks of writing left…..I think I might hate my thesis. Like it’s not bad, I just hate it

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

The first Pride was a riot in 1969, and the LGBTQIA+ community still has to protest for equality & represent for those of us who can’t be ourselves. June is never enough! End the worthless culture wars.

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

Nah it’s nothing like this! 🫣

[Martin Lenz @Going_Loopy]

Literally never gets old

[National Human Genome Research Institute @genome_gov]

Now that researchers have released a human pangenome reference, what’s next? Well, a lot more research to advance human health around the globe.

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

43,000 words and I feel like I have so SO much more to say...writing a PhD thesis is a bitch. Can't wait for this to be over with!

[Colossal Biosciences® @colossal]

Protecting our biodiversity is arguably the most pressing issue of our era, that’s why we’re signal boosting this subject in recognition of International Biodiversity Day. 🌎🌿🦭🪲

#science #conservation #startups #internationalbiodiversityday

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

And then there will be me, just printing (CATCATCATCATCATCATCATCAT)n and giggling away to myself

[Michael Mina @michaelmina_lab]

Soon, any lab will be able to synthesize their own DNA molecules

So too will ppl at home, much like how 3D printers are much more accessible

Great for innovation
Terrifying for biosecurity

Will be very tough to keep checks to prevent “homemade” viruses

https://t.co/w1QFo39kBM

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

This is THE coolest program. Undergrads & grads working as a mini-consortium to produce an amazing genome with @nanopore https://t.co/fHoIfOrzxN data. I was lucky to see the genome developing! Congrats to on the amazing program @JillWegrzyn and the great work @ScienceyNeitzey 😁

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

Just need some ultra-long nanopore to close those remaining gaps - I know a lab producing some crazy long reads @roneilllab 😉

https://t.co/pCefWuwOWK

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

@edgrady It's not really a floor!

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

Sometimes I feel like two day conferences are great, and sometimes they feel like this

[Patrick G.S. Grady, Ph.D. (he/him) @patrickgsgrady]

@rgrubinstein Yes!! I pointed it out to my seat neighbors and said “where do I get that!!!” 🙂