Samuel Hervey

Research scientist at Michigan Tech with interests in landscape ecology and conservation genetics

[Samuel Hervey @samuelhervey]

@takeatoothbrush Congrats Staci that's awesome!

[Taal Levi @taaltree]

We've been working on this paper out today (and open access) for over 7 years, so bear with me while I tell you the story of how we discovered that wolves kill and eat sea otters (Panels A-D) and what this means for wolves, otters, and deer. /1

https://t.co/mGbOeNtNVv

[TWS Molecular Ecology Working Group 🧬🐾🐦🐍🐟🌲 @TWS_MEWG]

📢@kristin_brzeski at @michigantech is recruiting a postdoc to develop genomic resources for red wolf and coyote conservation and management. Learn more below and apply now! 🐺🧬

[Michael 英泉 Eisen @mbeisen]

aacgaagtggaacgcggcaacaacgcgggcattgtggaatatccgaacgaagtggaacgcggcaacaacgcgctggaaacctatgattggaacaacgaagtggaacgcggcaacaacgcgcgcaacgcgcgcaacgatgcgaacgatgatgaaagcgaacgcacctataacgaagtggaacgcggcaacaacgcgatggcgaaagaatattgccgctataacgaagtggaacgcggcaacaacgcgagcgcgtatggcgattatgaa

[Samuel Hervey @samuelhervey]

Great opportunity with an awesome advisor!

[Brian Darby @BrianDarbyLab]

I am again looking to recruit students for 1-2 graduate research positions at the M.S. or Ph.D. level in #soilhealth and #nematodes related to grassland restoration, but would also be open to those interested in #microbiology and #protozoans. Let me know if you're interested!

[Samuel Hervey @samuelhervey]

@takeatoothbrush Congrats Staci!

[Samuel Hervey @samuelhervey]

@UNDBiology Congrats! @Lynda28991747

[Samuel Hervey @samuelhervey]

Good news everyone! Our article on the founding population of gray wolves recently translocated to Isle Royale is now available. @kristin_brzeski @EastWolfSurvey
https://t.co/hI7nvXnCPF

[Samuel Hervey @samuelhervey]

@BrianDarbyLab This was probably over three years ago, but I distinctly remember laughing to myself thinking, "Brian is going to hate this". Don't you miss me?

[Samuel Hervey @samuelhervey]

@AndrewBarnas No way...

[Jared Wolfe @JaredDWolfe]

Do #coyotes in #Louisiana harbor ghost alleles of locally extinct red wolves? To answer this question @kristin_brzeski & @joeyhinton22 are safely capturing & studying these awesome animals. Check out this beautiful young male outfitted with a GPS collar @mturesearch 🐺👩‍🔬❤️

[Samuel Hervey @samuelhervey]

Great opportunity with an incredible advisor!

[Susan Felege @FelegeLab]

I am looking to hire a 2-year #postdoc to work on #drones, #wildlife, and #AI in my lab. To learn more and apply: https://t.co/Q6obdTn6Bb

[Susan Felege @FelegeLab]

My non-twitter @UNDBiology colleague has a cool PhD position available in his lab in collaboration with ND Game & Fish. Neat project. Great advisor (ask @AndrewBarnas @samuelhervey & @TannerStechmann). #PhDposition #wildlife #Genetics #DiseaseEcology

[Susan Felege @FelegeLab]

Exciting new colalborative #drone paper out from my lab led by recent @UNDBiology PhD student @AndrewBarnas. @dioptrica. A standardized protocol for reporting methods when using drones for wildlife research - Journal of Unmanned Vehicle Systems: https://t.co/iqe9iMJlBS

[Susan Felege @FelegeLab]

My former grad student, @AndrewBarnas, had his dissertation research featured by the @wildlifesociety! Great work Andrew! #ornithology

[Susan Felege @FelegeLab]

My PhD student @AndrewBarnas will be defending his dissertation this Friday!

[Samuel Hervey @samuelhervey]

Good news everyone! Excited to announce our paper on nest parasitism and kin grouping is now available!
https://t.co/vDYlhfs8Wd

[Samuel Hervey @samuelhervey]

@AndrewBarnas @FelegeLab @TannerStechmann Thank you Mr. co author!

[David Iles @IlesDT]

Our paper examining diversity-stability relationships in Arctic geese is now viewable! We found that herbivore reproduction is more stable and less affected by climate in habitats with higher plant diversity. Very fun project!

https://t.co/50Ik2wIdvd

[Samuel Hervey @samuelhervey]

@takeatoothbrush Just try poking it?