STEMCELL Technologies

Committed to advancing life science research with innovative reagents, tools, and services. For product and technical support, email [email protected].

[STEMCELL Technologies @STEMCELLTech]

Editor-in-Chief of the Journal of Trial and Error, Dr. Sarahanne Field, challenges one of the most entrenched incentives in research: the pressure to publish only positive results.

In Season 3, Episode 4 of the Lab Coats & Life™ Podcast, she emphasizes how uncertainty makes researchers (and reviewers) uncomfortable, why “failing” to confirm a hypothesis often raises more valuable questions, and how the publishing landscape needs to evolve.

If you’ve ever had a well-designed study that didn’t behave the way you expected, listen in.

Listen wherever you get your podcasts!

[STEMCELL Technologies @STEMCELLTech]

Which one are you?
https://t.co/Scfzx5y4fS

More below ⬇️

[STEMCELL Technologies @STEMCELLTech]

Start scaling mesenchymal stromal cell (MSC) and extracellular vesicle (EV) production with greater consistency and control. Join Dr. Marta Costa (iBET) to learn practical strategies for optimizing bioreactor workflows, improving EV isolation, and using real-time monitoring to enhance manufacturing quality and yield for cell therapy applications.

Save your spot here: https://t.co/GFCaTY84ia

[STEMCELL Technologies @STEMCELLTech]

Check out our new, free on-demand course: Application of HSPCs in Cell Therapy. Whether you're already using CD34+ cells in translational workflows or just getting started, this course will help move your research closer to the clinic.

Register now: https://t.co/rklvMW4vpL

[STEMCELL Technologies @STEMCELLTech]

Are these green flag behaviors part of your cell banking routine? ✅

Whether you’re new to hPSCs or have years of experience, following cell banking best practices can help protect against variability, contamination, and unexpected setbacks while supporting reproducible results.

Here are some simple ways to build a more reliable, well-characterized cell bank from the start. Visit https://t.co/J20HDEJyjW to learn more.

[STEMCELL Technologies @STEMCELLTech]

Should scientists connect more directly with policymakers? 🏛️

The latest Lab Coats & Life™ Podcast explores how researchers can engage in policy, communicate clearly, and bring a human perspective to real-world decisions.

🎧 Listen wherever you get your podcasts.

[STEMCELL Technologies @STEMCELLTech]

POV: the dress code is strict… but you still make it fashion. 😎

Safety? Always.
Style? Non-negotiable.

#styleinspo #LabLife #STEMHumor #ScientistStyle #ootd #LabAesthetic

[STEMCELL Technologies @STEMCELLTech]

The #StemCellfie contest is returning in June 2026!

It’s time to put on your lab coat, clean your lenses, and prepare to dazzle the microscopy world with your best cell image. 🪩

Look out for the official start date on our social channels over the next few weeks. In the meantime, admire some of our top 20 winners from 2025. 🤩

https://t.co/MbrTyCmK98

[STEMCELL Technologies @STEMCELLTech]

Are you part of a life science journal club? 📝

Enter our contest for a chance to win a US$350 gift card (or equivalent) for your lab to spend on refreshments.

https://t.co/ueJqISAJob

[STEMCELL Technologies @STEMCELLTech]

Thank you to everyone who visited our booth or attended our Global Showcases! We enjoyed introducing our new Highway1™ Cell Sorter and GMP hematopoietic and immune cell media.

#ISCT2026 may be over, but we’re still here to support you with reliable reagents for revolutionary therapies. 🤩

🔬 Explore resources for your #CellTherapy research: https://t.co/gBjV4EvJ4Z

[STEMCELL Technologies @STEMCELLTech]

Scientific societies are about more than just annual meetings - they’re the backbone of research advocacy and mentorship.

New episode of Lab Coats & Life featuring Drs. Tenneille Ludwig and Rita Carsetti is out now! 🎧

Listen wherever you get your podcasts!

[STEMCELL Technologies @STEMCELLTech]

Join us today at #ISCT2026 to see how Highway1™ is helping streamline cell therapy workflows from bench to clinic!

Global Showcase Presentation by Scott Tasker:
Accelerating Cell Therapy: High-Speed, Closed-System Cell Sorting from Development to Manufacturing
📍Thursday, May 7 | 12:45 - 1:00 p.m.
📍Theatre A, Forum Floor (Ground Level)

Want to see the Highway1™ in action? Stop by booth #1110 for a live demo during these windows:
🗓️ Thursday: 1:00 - 2:00 p.m.
🗓️ Friday: 12:00 - 1:00 p.m.

[STEMCELL Technologies @STEMCELLTech]

Poster and pitch 🎤

Our collaborator, Dr. Ho Quan Yao, will be presenting new work at #ISCT2026!

🧪 Topic: Vortex-Actuated Cell Sorting Boosts Expansion of CRISPR-Edited Human Regulatory T Cells

This talk will highlight how gentle, closed-system sorting can support expansion of sensitive, gene-edited cell populations.

📍Join Dr. Ho Quan Yao this Friday, May 8 (8:00 - 9:00 a.m.) at the Immunotherapy Elevator Pitch Sessions.
📑 Abstract 1172

[STEMCELL Technologies @STEMCELLTech]

If you're at #ISCT2026 and working on translating cell therapies to the clinic, add this talk to your schedule.

Global Showcase Presentation by Nooshin Tabatabaei-Zavareh, PhD:
Next-Generation GMP Reagents for Hematopoietic and Immune Cell Therapy Manufacturing

Learn how serum-free media and targeted differentiation strategies can support:
• Reproducible HSPC expansion
• Controlled lineage commitment
• Flexible integration across workflows

Wednesday, May 6 | 7:00 - 7:15 p.m. Theatre A, Forum Floor (Ground Level)

[STEMCELL Technologies @STEMCELLTech]

GIVEAWAY! Win one of three pairs of our science socks.🧦

STEMCELL Science News delivers the latest research in immunology, cancer, and stem cell biology straight to your inbox.

Subscribe to any of the newsletters by June 30 for a chance to win: https://t.co/1u5prKQvr1

[STEMCELL Technologies @STEMCELLTech]

CGTACTGAGGAGGACAGCTACCTCACTAGCTACACTGAC

In other words, Happy #DNADay! 🧬

https://t.co/3AUryOeboP

[STEMCELL Technologies @STEMCELLTech]

It's hard to believe that #AAI2026 is already over! 🥺 We're delighted to have seen so many of you at our workshops, poster sessions, and booths.

Revisit the highlights from #IMMUNOLOGY2026 and prepare for #AAI2027: https://t.co/N85wwL7X0H

@ImmunologyAAI

[STEMCELL Technologies @STEMCELLTech]

✈️ Heading to #AACR2026 next?

Meet us tomorrow at booth #4829 as we support your cancer research in immuno-oncology, tumor biology, and cell therapy.

@AACR

[STEMCELL Technologies @STEMCELLTech]

Today is the final day at the #IMMUNOLOGY2026 exhibit hall! 📢

Swing by booth #511 for a final look at our instruments and discuss how we can support your #immunology research.