Martín

PharmD. - MSc. Bioinformatics

[Eric Topol @EricTopol]

Nature-based interventions are good for your health. A new systematic assessment (and they are free)
https://t.co/0xoorjvwss

[Janekeith @Janekeithduran]

Sigue la red de cuido y pago de favores. Ahora el chavismo quiere que Catalina Crespo sea la Secretaria General del SICA.

Lo único que supimos de su trabajo como embajadora es que se inventó que el Congreso de USA la había convocado. También tiene una causa penal pendiente.

[Martín @tin_rb]

Soy yo o solo NoPasaNada compartió alguna noticia sobre el HondurasGate? No les parece raro que ningún medio de comunicación grande publicó nada?

[Kenneth Roth @KenRoth]

Trump blocks visas for Costa Rica's leading newspaper because it broke a sexual abuse scandal involving the country's current president, who is a Trump ally. https://t.co/sij578FiDA

[Bernie Sanders @BernieSanders]

While the world focuses on the destruction in Iran, we must not ignore what Israel is doing in Lebanon.

1,461 have been killed.
4,430 have been injured.
1.2 million have been displaced.

Israel now occupies 14% of Lebanon.

Enough is enough. No more US military aid to Israel.

[Martín @tin_rb]

@fish_cb @Alo_Aloc Aaaah pero si fueran un montón de mechudos con picazón en el cuello

[Daniel Lambert @dlLambo]

Israel is the first state in history to legislate a death sentence that applies only to one ethnic group.

There's a reason nobody has ever done this.

It's a depth of evil beyond humanity itself.

[Martín @tin_rb]

@fish_cb @Alo_Aloc Caballero el concierto de narcos era privado, infórmese por favor

[Abraham Mendieta @abrahamendieta]

Si algún día te sientes estúpido, recuerda que María Corina Machado regaló el Premio Nobel de la Paz al tipo que bombardeó una escuela y mató a 150 niñas.

[Martín @tin_rb]

Pensando sacar libre el lunes porque
a) tengo que sopesar el gane de Laura Fernández en primera ronda y el futuro que nos espera
b) me tengo que recuperar del fiestón que se va a hacer en la Hispanidad por ir a segunda ronda

[Laura Chinchilla M. @Laura_Ch]

Se ha presentado una grave denuncia “urbi et orbe” en medio de un debate presidencial. Esto demanda explicaciones por parte del supuesto ofensor y acciones de seguimiento por parte de la afectada, de lo contrario se tendría derecho a dudar de su veracidad.

Usar la violencia de género con fines políticos y de campaña es profundamente inmoral e irrespetuoso, y reflejaría una falta de empatía con las víctimas de este flagelo social. No sólo se estaría jugando con la dignidad de las verdaderas afectadas, sino también contribuyendo a trivializar uno de los más graves epidemias sociales. No se consiguen votos pisoteando el sufrimiento ajeno.

#CostaRica 🇨🇷
#Elecciones2026

[cristian cambronero @cambronero]

Sin miedo.
Con votos.

[Scholarship for PhD @ScholarshipfPhd]

The irony

[Martín @tin_rb]

Qué bueno el reality show de OPA

[Ensembl @ensembl]

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

[Jay Van Bavel, PhD @jayvanbavel]

A new PNAS paper finds that polarization increased immediately after the invention of smartphones and the advent of social media, which both appeared around the same year, 2008.

Both profoundly changed the way humans communicate and this rise of connectivity may have fueled polarization. Adding a small number of individuals with extreme opinions (influencers) also drives continuous increases in polarization.

Once polarization occurs as a consequence of increasing connectivity, it can not simply be undone by reversing to previous connectivity levels. This may be why social media removal studies have very modest effects on polarization. https://t.co/bHNR8xtTks

[Martín @tin_rb]

Cualquier café puede ser un carajillo si uno se lo propone

[William A. Wallace, Ph.D. @WilliamWallace]

What actually happens to caffeine after you drink it?

your liver breaks caffeine into three separate biologically active molecules, each with different effects.

This pathway shows exactly how your body metabolizes caffeine, and why people respond so differently to the same cup of coffee.

When caffeine enters the bloodstream, 95% of its metabolism occurs in the liver and is controlled by the enzyme CYP1A2, one of the most genetically variable drug-metabolizing enzymes in humans.

Caffeine (1,3,7-trimethylxanthine) is broken down into three major metabolites:

1️⃣ Paraxanthine (1,7-DMX) - 84% of caffeine metabolism

This is the dominant metabolite.
Paraxanthine increases lipolysis, raises free fatty acids, and enhances alertness without as much vasoconstriction as caffeine itself.
Further metabolism produces AFMU, 1-methylxanthine, and 1-methyluric acid through NAT2 and XO pathways.

2️⃣ Theobromine (3,7-DMX) - 12%

Theobromine is the primary stimulant in chocolate.
It acts as a vasodilator, smooth muscle relaxant, and mild diuretic.
It is further metabolized into 3,7-dimethyluric acid via xanthine oxidase.

3️⃣ Theophylline (1,3-DMX) - 4%

Theophylline has bronchodilating properties and is actually used clinically for asthma.
It is metabolized into 3-methylxanthine and 1-methylxanthine through CYP1A1 and CYP1A2 pathways.

🧬 Why this diagram matters

Genetics determine how fast you metabolize caffeine.

Fast metabolizers (CYP1A2*1A) clear caffeine quickly → fewer jitters, higher tolerance, shorter half-life.

Slow metabolizers (CYP1A2*1F) break it down slowly → stronger effects, longer half-life, higher risk of sleep disruption and blood pressure effects.

NAT2 and other enzyme variants shape downstream metabolite balance.

This is why some people can drink coffee at 9 p.m. with no issue…
and others get heart palpitations from half a cup.

Your caffeine response isn't random, it's biochemistry + genetics.

📚 Source
Nehlig A. “Inter-individual differences in caffeine metabolism and factors driving caffeine consumption.”

[Massimo @Rainmaker1973]

Did you know?

An explosion of zinc fireworks occurs when a human egg is activated by a sperm enzyme, and the size of these “sparks” is a direct measure of its ability to develop into an embryo.

In other words, life begins with a flash of light.