Sebastian Konrad

photography, climbing & the outdoors.

[Sean Cutler @cutlersr]

Proud of this one.
https://t.co/WBguH8FDzg
@LabWheeldon @BeltranJBio @bvolkie @NusinowLab

[Sebastian Konrad @SebastianKonra4]

@tontondavid10 @ShappiKhorsandi Printing on canvas does not require much resolution since the images won't be sharp anyways, but still, that's a weird approach...

[Sebastian Konrad @SebastianKonra4]

@ReskiLab Gewitterblume fehlt 🙂

[Sebastian Konrad @SebastianKonra4]

@SRBailey32 @brieski I've made the transition from academia to industry 6 years ago (Medtech now) ans honestly, i've never been more able to pursuit what interests me more than now.
Purpose and meaningful work is also a great motivator and i have that more now than in academia.

[Marco Hein @marcoyannic.bsky.social @marcoyannic]

Some scientific illustrations become memes*, some turn into cultural icons.
It requires a combination of originality, aesthetic, simplicity and scientific accuracy.
Here are some of them 🧵
1/n

*memes in the original sense: units of cultural inheritance that replicate and evolve

[Michael 英泉 Eisen @mbeisen]

aacgaagtggaacgcggcaacaacgcgggcattgtggaatatccgaacgaagtggaacgcggcaacaacgcgctggaaacctatgattggaacaacgaagtggaacgcggcaacaacgcgcgcaacgcgcgcaacgatgcgaacgatgatgaaagcgaacgcacctataacgaagtggaacgcggcaacaacgcgatggcgaaagaatattgccgctataacgaagtggaacgcggcaacaacgcgagcgcgtatggcgattatgaa

[Sebastian Konrad @SebastianKonra4]

@carolabender Hast Du unterm Sofa aufgeräumt :)

[Sebastian Konrad @SebastianKonra4]

@Flexi23 Congratulations Felix. Welcome to the world of sleepless nights and joyfull days

[Sebastian Konrad @SebastianKonra4]

@DrRichJohnston @AimSwansea Beautiful Image and very nice LUT. I Hope you scanned the rest of the moth, too

[Sebastian Konrad @SebastianKonra4]

@UnionX14 @ElisabethKaleko @Karl_Lauterbach Weil es hier nochmal steht: diese Aussage ist falsch. Gentherapie= Änderung des Gens(DNA). MRNA = Änderung des Genprodukts. Hört sich nach dem Gleichen an, macht aber einen großen Unterschied

[Sebastian Konrad @SebastianKonra4]

@UnionX14 @EpitaphJoe @ElisabethKaleko @Karl_Lauterbach Nein ist es nicht.

[Steve Paterson @scottishwormboy]

Letting a virus rip through a partially vaccinated population is exactly the experiment I’d do to evolve a virus able to evade immunity

[Sebastian Konrad @SebastianKonra4]

@ReskiLab Photoshop hat nicht per se etwas mit Bilderfälschung zu tun. Vielleicht hat der/die Kandidatin ein solides Grundverständnis von Bilddaten und kann so frischen Wind in die Auswertung von Mikroskopiedaten bringen. Ganz abgesehen von der visuellen Aufbereitung von Grafiken...

[Ralph Ruthe @ralphruthe]

Damit alle kapieren, wie Triage funktioniert: wenn ihr jetzt mit Blinddarmentzündung ins Krankenhaus kommt, kann es passieren, dass man sagt "Dafür haben wir keine Kapazitäten".
Dann sterbt ihr. An Blinddarmentzündung. In 2021. Weil wir nicht für alberne 3 Wochen Büros zumachen.

[MPI for Biological Intelligence @MPIforBI]

📢 Registration is open for our internship program @mpiNeuro and @MPI_Biochem.
Apply now and spend the summer in Munich: https://t.co/pn7rTfDjqZ
#internship #neuroscience #undergrad @maxplanckpress

[Sebastian Konrad @SebastianKonra4]

@DDcyclist Ein herzliches "Tschu Tschu Wa" zurück!

[Littlewisehen @littlewisehen]

Mehr muss man dazu nicht sagen...

[Alex Sexton @SlexAxton]

I feel like we didn’t focus enough on the fact that someone in the Trump campaign meant to schedule the “four seasons hotel” but definitely accidentally scheduled this “four seasons landscaping” store and they had to follow through with it. Veep was not this good.

[tagesthemen @tagesthemen]

Wir haben da mal ein bisschen an unserem Sound geschraubt. Wie gefällt's? #tagesthemen #tagesthemenintro