Aggie O

ex-AFP▫️med + genetics▫️academic med, clinical genetics, rare diseases, muscle▫️she/her▫️views own

[Tom Wright @TWright_GenomeX]

Final talk in the “Big data and AI” session #BSGM2024 Prof Pagnamenta @alistairp2011 @UniofExeter expertly sharing examples where several new #rare diagnoses were made by searching haploinsufficient genes for inversions, complemented with RNAseq assessments 👏

[Aggie O @aogenetix]

Very interesting talk on finding missing PKU diagnoses presented by Rachael McNeilly at #BSGM2024 . Using WGS, targeted Sanger seq. and manual reanalysis of NGS data, they identified >30 missing second recessive PAH variants @SWGLH @BritSocGenMed

[JWMDRC @jwmdrc]

We're celebrating Duchenne Awareness Day to raise awareness for the devastating disease.

We work on the DMD Hub & DMD Care UK projects with @DuchenneUK, are a centre of excellence providing care for patients nationally & deliver cutting edge clinical trials.

#WDAD2024

[William Fostier @WFostier]

📨 Open letter to @UKFPO and @NHSEngland: Reverse the changes to the Specialised Foundation Program (SFP).

The letter is available here with updated signatures: https://t.co/RR95MXayD8

[Luke Mordecai @Shr_Nottingham]

An absolutely scathing indictment of the associate project from one of the few people absolutely qualified to have an opinion

Thank you for speaking up @Adam_Skeen and if you’re a 🇬🇧 doctor not worried about professional standards, you should read this!

https://t.co/xkTsqdonxz

[Unique @Unique_charity]

It's #RareChromoDay! Celebrating anyone living with a rare chromosome or gene condition and their families and carers. Please show your support...
More at https://t.co/bOANMvZpsk
#unique #RareChromosomeDisorder #GeneDisorder #RareDisease #Genetics #UniqueButNotAlone #rarechromo

[BSGM @BritSocGenMed]

📢 Abstracts are open!

Join us at the #BSGMConference2024
at📍the Royal College of Physicians📅on 5th Nov

This year’s themes include AI, the power of big data and gene therapies🧬

⏱️Abstracts close 1st July

#Genetics #Genomics #RareDisease

https://t.co/ZbhpnA5YkY

[Anneke Lucassen @annekeluc]

here is a link to the full article: https://t.co/GqHC2BLPiE

[JWMDRC @jwmdrc]

We are celebrating #RareDiseaseDay with @M4RareDiseases by taking part in #ShowYourStripes!

People impacted by rare conditions face similar challenges because of a lack of awareness. Help spread awareness this Rare Disease Day!

[Newcastle University @UniofNewcastle]

Did you know rare diseases aren't that rare?

With around one in 17 of us directly affected by a disease @NCL_RareDisease are working with @NHIPartners and @NewcastleHosps to make sure treatments aren't rare either.

#WeAreNCL #RareDiseaseDay @RareDiseasesEU

[NHS Central and South Genomics @CaS_Genomics]

Want to learn more about rare diseases? Watch this video, with CEO of @M4RareDiseases Lucy McKay, in which she introduces #RareDiseaseDay and signposts to resources - available here: https://t.co/VBoo1MGj36
https://t.co/DGRT5VKepz

[MedicsforRareDisease @MedicsForRare]

One last reminder! 🧦 It's Rare Disease Day tomorrow and we're super excited to see all of your stripey socks! Remember to tag us @M4RareDiseases and use the hashtag #ShowYourStripes - you can even nominate a #RareAlly ! Go wild! 🦓👏

[Aggie O @aogenetix]

fun day at #GeneticsMatters representing @M4RareDisease while talking to the public, patients and anyone interested in genetics and rare diseases #DareToThinkRare #ShareYourStripes #RareDiseaseDay

[MedicsforRareDisease @MedicsForRare]

Join in and #ShowYourStripes for #RareDiseaseDay on 29th February, the rarest day of the year! Getting involved is easy, simply dig out some stripey socks, pop them on and take a stripey, socky selfie with the hashtags #ShowYourStripes for #RareDiseaseDay 🦓🧦👍😀

[Aggie O @aogenetix]

as usual, fab day at the @M4RareDiseases unusual suspects: rare disease in everyday medicine annual symposium - incredible speakers and always feels great to be around others also passionate about #RareDiseases

[BMA Students @BMAstudents]

We fundamentally disagree with the decision by the UK Health bodies to move the Specialised Foundation Programme into the PIA system from 2025 and will fight for students by resisting this change in any way that we can.

Read the full statement 👇https://t.co/DXtM0hCPUk

[World Muscle Society @WorldMuscleSoc]

This International Day of Women and Girls in Science, we are celebrating the women working in the field of neuromuscular disorders and inspiring the next generation. Here are the fantastic women of the John Walton Muscular Dystrophy Research Centre in Newcastle. #WomenInScience

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at
@ensembl

[Clare Turnbull- Prof/NHS Dr @clare__turnbull]

Today in the @TheLancet, we UK geneticists argue: "Population screening requires robust evidence—genomics is no exception"
@annekeluc, @HelenVFirth, @GeneticBill, @carolinefwright, @mgtmccartney, @wilkie_lab, @RobinLachmann,@group_tomlinson,@lucymedgen https://t.co/Hr60KCUU8g

[MedicsforRareDisease @MedicsForRare]

February is just around the corner and we're giving you the heads up to register now for our next Unusual Suspects event on February 21st! 😍

We can't wait to see you!

https://t.co/7lRLXa3fvY