Arnab Mukherjee

Researcher 👨‍💻🔬

[Global Change Biology @GlobalChangeBio]

Sea Ice Freezing and Melting Modulate the Estuarine Sediment Nitrogen Removal Process Through Affecting the Microbiome

🔗 https://t.co/GXuFe67YSv

[Arnab Mukherjee @ArnabM_27]

I am excited to share my research is now published! 📚
Probing the microRNA landscape in cadmium chloride induced renal toxicity through an in silico approach
https://t.co/GwqP86fofy
@SN and #SNAuthor.

[Arnab Mukherjee @ArnabM_27]

@tecmint MS office365

[Science Magazine @ScienceMagazine]

An #AI model created to design proteins simulates 500 million years of protein evolution in developing a previously unknown bright fluorescent protein.

Learn more in a new Science study: https://t.co/klcE9wFRco

[Marco Hein @marcoyannic.bsky.social @marcoyannic]

Some scientific illustrations become memes*, some turn into cultural icons.
It requires a combination of originality, aesthetic, simplicity and scientific accuracy.
Here are some of them 🧵
1/n

*memes in the original sense: units of cultural inheritance that replicate and evolve

[News Algebra @NewsAlgebraIND]

BIG NEWS 🚨 PM Modi will inaugurate Nalanda University campus tomorrow. Another HISTORIC work by PM Modi 🔥🔥

The head of missions of 17 countries will attend the function. It will be the replica of the historic Nalanda University.

Bakhtiyar Khilji destroyed Nalanda University in 1190s.

PM Modi will visit the ruins of ancient Nalanda.

[Manipal Institute of Technology, Manipal @MIT_MANIPAL]

MAHE is currently accepting applications for our PhD program (Batch 1), if you're passionate about pursuing doctoral studies and making significant contributions to your field, then this program is perfect for you. Apply now & embark on a journey of academic and personal growth

[Palki Sharma @palkisu]

My remarks at the Oxford Union almost a yr ago have made their way across social media. I gave a perspective on what has changed in India, citing events & anecdotes to support my argument. I’m overwhelmed to see how it has resonated with so many of you.🙏
https://t.co/vAeNC9R8a8

[News Algebra @NewsAlgebraIND]

BIG BREAKING NEWS 🚨 External Affairs Ministry said Bharat is concerned & closely monitoring the protests happening in the US universities 😂🔥

"India is in support of Freedom of Expression"

New India responding in the same language as US always comments on India's affairs.

EAM said ⚡- "Afterall, we are all judged by what we do at home and not what we say abroad"

[Science Magazine @ScienceMagazine]

In two independent Science studies, researchers used time-resolved crystallography at an x-ray free electron laser to capture the process of #DNA repair from picoseconds to microseconds.

Learn more on #DNADay ⬇️
📄: https://t.co/GlRfbfSUt6
📄: https://t.co/R22Dk0HVyo

[Mr Sinha @Mrsinha]

What a brilliant speech by @palkisu at Oxford Union.

Destroyed all the anti India propaganda in just 13 minutes..

[UCSC Genome Browser @GenomeBrowser]

We are excited to announce the release of the AbSplice scores track that was previously only on hg38 and is now also available on hg19. The scores represent the probability that a given variant causes aberrant splicing in a given tissue.

More info at https://t.co/ryUAtnX8vQ

[News Algebra @NewsAlgebraIND]

BIG NEWS 🚨 Respected Journalist Palki Sharma busts fake propaganda against Modi Govt at Oxford Union Society 🔥🔥

She said "If India is a poor democracy, Did BJP win the Karnataka or Telangana elections. Were the EVMs faulty then as well?"

"Bharat’s per capita income has doubled since 2014"

"Modi’s India got its much-deserved political stability. India isn’t a troublemaker but a consensus builder.

"Modi’s Kashmir went through economic resurgence and landmark social reforms"

"Social media misinformtion campaign against the rising Bharat is fierce today" ⚡- Palki Sharma

[ASHG @GeneticsSociety]

Better prevention, detection, and targeted therapies for cancer are developed due to @NIH-funded research. In our advocacy fact sheet, gain insights into how human genetics researchers seek to better understand various cancer types: https://t.co/OUAH4HoL1E #ASHG

[Arnab Mukherjee @ArnabM_27]

Do you remember when you joined X? I do! #MyXAnniversary

[Arnab Mukherjee @ArnabM_27]

Discover how big data and machine learning are revolutionizing personalized medicine in our latest review.
#MultiOmics #BigData #DrugDiscovery
Take a look at our article! https://t.co/yO5KD0tGBY

[Ensembl @ensembl]

🎄✨ 🎄✨ We have a Christmas riddle for you today! 🎄✨🎄✨ TGGCACGCCACCATCAGCAGCGCCAACACCGCCAGCAACATCAACACCCACAGGGAGATCAACGACGAGGAGAGGTGCGCCCTGCTGGAGGAC

[Oliver Jumpertz @oliverjumpertz]

Gets me every time.

[Kresten Lindorff-Larsen @LindorffLarsen]

AlphaFold structures might be as good as experimental structures for virtual screening

[Re-energising Your Career @career_re]

#AcademicTwitter Come on Santa!😂#phdvoice #phdlife @PhD_Genie