Jiale Chen

Ph.D candidate in Leiden University

[The Nobel Prize @NobelPrize]

BREAKING NEWS
The 2026 #NobelPrize in Physiology or Medicine has been awarded to Karl Deisseroth, Peter Hegemann and Georg Nagel “for their discoveries concerning light-gated ion channels and optogenetics.”

[Miles Ma @miles_mazy]

https://t.co/sx5Y7d8sJq

[Jiale Chen @jl_chen1]

A Meier–Gorlin syndrome mutation impairs the loading of the MCM2–7 complex during DNA replication initiation | PNAS https://t.co/5TQmuR9QIr

[Oscar Arias @OACerebro]

Enjoy!

https://t.co/YybiZJvXP8

[Diego A. Díaz-García @diegoadiazg]

🧬 Epigenetic editing: from concept to clinic.

Epigenetic editing enables durable gene expression reprogramming without altering DNA sequence.
Early concerns on efficacy and specificity are being addressed through improved understanding of epigenetic maintenance, targeting precision, and delivery systems. First clinical trials are now underway.

📖 @NatRevDrugDisc
DOI 👉🏻 10.1038/s41573-025-01323-0

#CánCare #oncology #cancer #epigenetics #precisiononcology

[Ming "Tommy" Tang @tangming2005]

An introduction to Python for R users https://t.co/2Fq9aihiOh

and I built an app to play with R and Python Code on the web browser for free https://t.co/RZEEI79DVv

[Ensembl @ensembl]

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

[Naveed Tavakol, PhD @naveedtavakol]

Join us this fall for a Cold Spring Harbor Lab meeting (Sept 28 - Oct 1, 2025) on "Bioengineered Tissue Systems & Models" on Long Island, New York. Co-organized by myself, my advisor Gordana Vunjak-Novakovic @GVNlab & collaborator Mirjana Maletic-Savatic:
https://t.co/6UXAMCAuan

[Jiale Chen @jl_chen1]

can’t wait!

[Wei Xie @xielablife]

The Cold Spring Harbor Asia (CSHA) meeting - Nuclear Architecture and Function is coming up soon! (Sept 1-5, 2025). Abstract submission deadline extended to July 18. Fantastic speakers & beautiful city (Suzhou) with Royal Garden. Check out here: https://t.co/jER6uINI8D

[EMBL-EBI Training @EBItraining]

Join us next week to discover how Biochatter can help you apply the power of LLMs to your biomedical research. Registration is free but essential: https://t.co/m23sbY0hj1 #LLM #LargeLanguageModel #AI #AIinScience #AIinBiology #bioinformatics #datascience #webinar @emblebi

[EMBL-EBI Training @EBItraining]

We've added two new webinars to our immensely popular series on #LLMs in #bioinformatics:

➡️Domain-specific knowledge extraction from scientific texts using LLMS

➡️A live Q&A featuring all the speakers from this series

Find out more and register here: https://t.co/qKC9oxe8iR

[nature @Nature]

Women tend to live longer than men and are often more resilient to cognitive decline as they age.

Now researchers might have uncovered a source for this resilience: the second X chromosome in female cells

https://t.co/oPNlrmMfV0

[Feng Yue @yuefeng_1]

Excited to share our latest work, showing GATA6 is a critical regulator in colorectal cancer and 3D genome organization. Led by Huijue, Zoe and thanks to our wonderful collaborators @LuWangLab and Dr. Guanyu Yang. @LurieCancer @NUFeinbergMed

https://t.co/j7yRlf0Kn1

[Jiale Chen @jl_chen1]

Congrats on Prof. Wang’s lab, which shed a new light on bioinformatics with AI.

[Ming "Tommy" Tang @tangming2005]

Foundation models in bioinformatics https://t.co/MCuSMyxGAM

[Wei Xie @xielablife]

Chromatin folks: don't miss GRC/GRS Genome Architecture in Cell Fate and Disease, June 15-20 2025 Ventura, CA. Registration deadline: Mar 18, 2025. https://t.co/Wc1h5YTKDq

[Mohammad Arifuzzaman @dr_arifuzzaman]

We are hiring a #postdoc and a research technician at @WeillCornell Medicine - Cornell University in New York City! We study the impact of diet and gut microbiota on inflammation, immunity, metabolism, and cancer. Join us if you are interested in #immunology and the #microbiota.

[Jiale Chen @jl_chen1]

happy new year

[EMBL Events @EMBLEvents]

Are you looking forward to 2025 as much as we are? 👀

We just updated our 2025 EMBL Annual Poster to include even more courses and conferences for you to join, so go and have a look!

➡️ https://t.co/QMAxOlmGbR

#EMBLEvents #molecularbiology #lifesciencetraining

[Jiale Chen @jl_chen1]

So excited!!!

[Pushmeet Kohli @pushmeet]

We love the excitement & results from the community on AlphaFold 3 and are doubling the AF Server daily job limit to 20. Happy to also share that we're working on releasing the AF3 model (incl weights) for academic use, which doesn’t depend on our research infra, within 6 months.

[Jiale Chen @jl_chen1]

This scientist treated her own cancer with viruses she grew in the lab https://t.co/9Oxm6XygU9