Rutuja Gupte

Biotechnologists

[TOLERATEnetwork @TOLERATEnetwork]

Congratulations to Prof. Vanhoorelbeke on receiving the title of Professor Honoris Causa from the Semmelweis University in Budapest. A truly prestigious and well-deserved distinction! 🎓

@kvhoorel @semmelweishu @KU_Leuven
#Thrombosis #TTP #ADAMTS13

https://t.co/mD4bbVlR1w

[immunoboys, MD/PhD @immunoboys]

What are CD4+NKG2D+ T cells doing? The literature is a bit heterogeneous (some mouse/some human, some healthy, some disease states).
In Dai et al – 2009 @JExpMed human CD4+CD8-NKG2D+ T cells from healthy individuals were autoreactive and producers of IL-10 and TGFb

[TOLERATEnetwork @TOLERATEnetwork]

Today marks #RareDisease Day, highlighting the 300M+ affected by 6000 rare conditions. This year, it's on the rarest day in 4 years, February 29th! Join in - #ShowYourStripes and learn more @rarediseaseofficial & https://t.co/1FWxCVZDR7
#MSCA #HorizonEU #EUfunding #EuropeanUnion

[Jonathan Pritchard @jkpritch]

It's a pity that All of Us used UMAP to visualize ancestry variation in their new marker paper, out today in Nature.
The UMAP algorithm, by design, exaggerates the distinctiveness of the most frequent ancestries, a message that can be misinterpreted by the public.

[Ang Cui, Ph.D. @AngCuiPhD]

✨#ImmuneDictionary✨is out today in @Nature!

Paper https://t.co/XY47lyphjU
Software https://t.co/duoWWcBmTj

We created scRNA-seq dictionary of 17+ immune cell types responding to 86 cytokines in vivo, discovered the immune system is far more complex than previously known 1/

[Daniela Latorre @LatorreDanielaa]

🔬 Delighted to share our lab's debut paper in @Nature. We unveil the first proof of autoreactive CD4+and CD8+ #Tcells infiltrating and targeting peripheral nerves in #Guillain-Barré Syndrome patients, reshaping our understanding of #GBS #autoimmunity. 👉 https://t.co/WlghuTA6cd

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at
@ensembl

[Alexandre Bolze @alexbolze]

Our latest study is live on @medrxivpreprint
https://t.co/uWb4PuJzU7

We asked why some (unvaccinated) individuals remain asymptomatic after SARS-CoV-2 infection, using 3 large cohorts.

And learned a lot on HLA & role in chronic phase of infection vs. acute phase

Check 🧵

[TOLERATEnetwork @TOLERATEnetwork]

💬DCs presented the progress and results of their research 🌈Hands-on training in Flow Cytometry and Microscopy by Erik Mul, Mark Hoogeboezem, and Simon Tol from @sanquin.👏🏻 Thanks to our partners at @sanquin for organizing and ensuring the success of the 1st meeting. 🧵2/2

[TOLERATEnetwork @TOLERATEnetwork]

1st annual meet in Amsterdam! 🧑🏻‍🏫 Immunology training by Dr. Wolkers, Dr. Amsen, Dr. Rispens from @sanquin, and Dr. den Haan from @amsterdamumc.🗣Therapeutic products aspects training by Dr. Barneda & Dr. Cools.📝 Management of data training by Dr. Ferguson (@DANS_knaw_nwo). 🧵1/2

[David Steensma, MD @DavidSteensma]

Did you ever wonder why our marrow is located inside of our *bones*, #MedTwitter? There’s no a priori anatomical reason it should be sited there. Blood cells could form in our spleens & livers, as they do during our fetal lives; or elsewhere, as in some animals. Let’s discuss! /1

[Julian Grünewald @grunewaju]

First approval for a #CRISPR therapy in the world. UK MHRA has authorized Exagamglogene autotemcel (Casgevy) this morning. What a historic and uplifting day for patients and for the gene & cell therapy field. https://t.co/n0NQxwbdRs

[TOLERATEnetwork @TOLERATEnetwork]

Swipe left to know more about #iTTP.
#autoimmunity #MarieSkłodowskaCurieActions #msca #horizonEU #EUfunding #research #thrombosis #haemostasis

[TOLERATEnetwork @TOLERATEnetwork]

What are the current treatment strategies for #iTTP and where does @TOLERATEnetwork come into the picture?
Swipe ⬅️ to know more!
#autoimmunedisease #drugdevelopment #immunology #treatment #haemostasis #thrombosis #research #MarieSkłodowskaCurieActions #msca #horizonEU #EUfunding

[anand mahindra @anandmahindra]

A bunch of IIT Bombay guys have made us proud again. They’ve created the first foldable diamond frame e-bike with full-size wheels in the world. That makes the bike not only 35% more efficient than other foldable bikes but it makes the bike stable at higher than medium speed. And it’s the only bike that doesn’t have to be lifted after folding. Took my very own HORNBACK X1 for a spin around the office compound! (Full disclosure: I have invested in their startup.) Hornback is available on Amazon as well as on Flipkart
@hornback_bike

[Mauro Corrado @MauroCorradoBio]

The total mass, number, and distribution of immune cells in the human body: ~2 trillion cells collectively weighting ~1.2 kg (40% are lymphocytes, 10% macrophages) https://t.co/Z07eSaTLzG

[TOLERATEnetwork @TOLERATEnetwork]

In addition to scientific meetings, the DCs will actively participate in social exhibitions to highlight their work to the general public. The aim is to educate scientific developments while also sensitizing DCs about their social responsibilities as #futurescientists. Post 3/3

[ISRO @isro]

Chandrayaan-3 Mission:
All set to initiate the Automatic Landing Sequence (ALS).
Awaiting the arrival of Lander Module (LM) at the designated point, around 17:44 Hrs. IST.

Upon receiving the ALS command, the LM activates the throttleable engines for powered descent.
The mission operations team will keep confirming the sequential execution of commands.

The live telecast of operations at MOX begins at 17:20 Hrs. IST

[TOLERATEnetwork @TOLERATEnetwork]

Meet the #TOLERATE Doctoral Candidates! 🎓🔬
🔬 Diverse in nationality & scientific background, 8 DCs have joined TOLERATE across European institutions. Collaborating internationally, we aim to develop new #iTTP therapies. Follow us for updates! #MSCA #twitterforscience Post 1/3

[TOLERATEnetwork @TOLERATEnetwork]

During their #PhD tenure, the DCs will benefit from the technical expertise of their own labs while also learning the techniques that other institutes in the consortium bring to the table. This would ensure bidirectional growth, ultimately benefitting the patients. Post 2/3