Nicola de Prisco

🇮🇹Postdoctoral research scientist in the @gennarinolab @Columbia medical Center in the city of New York 🇺🇸#neurodevelopment #RNAregulation #zebrafish

[Nicola de Prisco @nicdepris]

Very happy to share our story about alternative polyadenylation just published on @ScienceAdvances https://t.co/8wl2UkvfQL First paper from @GennarinoLab @ColumbiaGenDev.
A thread 🧵

[Vincenzo A. Gennarino @AlexGennarino]

Alpha-synuclein abundance and localization are regulated by the RNA-binding protein PUMILIO1: Cell Reports https://t.co/6Ue20bKxaL

[Nicola de Prisco @nicdepris]

If you are looking for a place where to do postdoc, I really recommend checking the Gennarino lab out!!

[Gennarino Lab @GennarinoLab]

The Gennarino Lab is looking for scientists! Are you a curious, ambitious, and motivated scientist who love to dive inside complex biological questions aimed to understand the mechanism of neurological diseases? Then we are looking for you. Visit our website to learn more.

[Gennarino Lab @GennarinoLab]

The Gennarino Lab is looking for scientists! Are you a curious, ambitious, and motivated scientist who love to dive inside complex biological questions aimed to understand the mechanism of neurological diseases? Then we are looking for you. Visit our website to learn more.

[Nicola de Prisco @nicdepris]

Gennarino lab is looking for postdoc. Very cool lab in a super cool place!!

[Ensembl @ensembl]

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at
@ensembl

[Sternberg Lab @SternbergLab]

New pre-print from the Sternberg Lab! Transposon-encoded nucleases (TnpB/IscB) gave rise to the CRISPR-associated proteins (Cas9 and Cas12), but were TnpB-like proteins domesticated for other functions? 𝙔𝙀𝙎!! https://t.co/ImPdkqLaqz

[Nicola de Prisco @nicdepris]

@DebVendramini @arianamusa @myree_g @RAFrancescone @HCCvPDAC We miss you too!!!❤️

[Nicola de Prisco @nicdepris]

@MichaelLee04 @BiodockAI amazing!

[Veera Rajagopal  @doctorveera]

A fascinating work is published today @Nature by Zhang & Zhang et al. on a serendipitous discovery of haemoglobin expression outside the RBC cells--in chondrocytes--and their critical role in keeping our cartilage alive under an oxygen-deprived environment.

https://t.co/DPhuZN1JGE

Our school teachers taught that haemoglobin (Hb) is an oxygen-transporting protein expressed exclusively in the red blood cells. Although there exist occasional sporadic reports of Hb expression outside the RBCs (e.g. neurons, retinal cells etc.), no one would have guessed Hb would play a critical role (required for survival) outside the RBCs.

The discovery
When studying the cartilage growth plate of neonatal mice, the authors noticed eosin-positive structures in the chondrocytes (cartilage cells) that resembled structures seen in RBCs. Out of curiosity, the researchers went on to stain and examine the chondrocytes of different cartilage tissue types both from mice and humans. They realized that no matter the source or species, the cells always displayed eosin-positive structures under the microscope.

The curious researchers were determined to find out what these structures are made of. They carefully dissected these structures out and studied the protein components using mass spectrometry and were surprised to learn the results: the top hits were Hb proteins.

Unable to believe the results, they went on to study the proteins using different methods--western blotting, immunohistochemistry--and every time they ended up with the same results: the cytoplasm of cells was loaded with organelles-like bodies made of haemoglobin proteins. Finally, they came to the realization that Hb is abundantly produced in chondrocytes. They named these cytoplasmic Hb bodies as "Hedy".

Structure of Hedy
The authors studied the structure and formation of Hb bodies floating in the cytoplasm. Are they like an organelle? Do they have a membrane? Through various experiments, the researchers found that the Hedy structures do not have a membrane. The Hb proteins condense together by phase separation to form organelle-like structures in the cytoplasm. This condensation is itself an evolved process, requiring specific sequence structures of the Hb protein.

Globin switching
We know that there are different forms of Hb each expressed during different developmental stages: embryonic, fetal and adult Hb. There exists a sophisticated molecular machinery (which was believed to be RBC-specific) that switches one Hb type to the other at appropriate times. Using gene silencing experiments, the authors were further awestruck to find that the chondrocytes too switched their Hb types from embryonic to fetal to adult stages, just like RBCs!

Regulation of chondrocyte Hb production
It is well known that hypoxia induces Hb production via upregulating hypoxia-inducible factors (HIFs), an evolutionarily conserved molecular mechanism (Nobel Prize 2019; https://t.co/Sifi8LuYIX). But it turned out that chondrocytes have evolved to increase their Hb expression not via HIF proteins, but through a different protein, the same protein that is required for fetal to adult Hb switching: KLF1 (https://t.co/Zn0X8GpYdq).

How important is Hb for chondrocytes?
Such a high Hb expression in chondrocytes with similar globin switching behaviour as RBCs would mean that this Hb is critical for chondrocytes' survival. By deleting the Hbb gene specifically in the chondrocytes, the authors found that without Hb the chondrocytes die killing the animal a few days after birth.

Conclusion
Continuous oxygen supply is a prerequisite for the survival of cells in all tissues. The only way the cells can receive oxygen is through RBCs in the blood, which requires the tissue to be highly vascularized. When demand exceeds the supply, the cells evolve to survive an oxygen-depriving environment.

Muscles evolved to produce their own globin--myoglobin which has a higher affinity to oxygen than Hb thereby withholding O2 during oxygen excess states and releasing it back during oxygen-deprived state (during exercise). Likewise, the brain has its own globin: neuroglobin (https://t.co/6v78zvHajP).

Today, we are learning that cartilage (an avascular tissue), too, has its own globin. But unlike muscle and brain, have evolved to store oxygen not by making a new type of globin but by making just the same type as the ones in RBCs, but with a higher affinity than RBC Hb.

When it comes to fundamental biology, we often assume that we have found everything and then one day a discovery like this drops, hitting us on the head to make us realize that there is a whole universe of hidden biological secrets waiting to be discovered.

Some recent posts:
1. Gene x sex interaction of PNPLA3 I148M variant (https://t.co/RFegHHRS2z)
2. Effect of consanguineous marriage on the risk of common diseases in offsprings (https://t.co/dTkPsl935K)
3. Whole genome vs. Whole exome sequencing. Which is more cost-effective for genetic association studies? (https://t.co/BCwMzw4g16)

[Nicola de Prisco @nicdepris]

Very good @Pas_Piccolo and his group!
👏👏👏👏

[Nicola de Prisco @nicdepris]

Glad to receive the nomination for the postdoctoral 2023 excellence award from @AlexGennarino and the Columbia University Office of Postdoctoral Affairs

[Gennarino Lab @GennarinoLab]

Congratulations to @MaxCabaj who received the award for best talk at our most recent genetics and development retreat. Outstanding presentation!

[Smeetonlab @smeetonlab]

📢Tendon/ligament/regeneration enthusiasts! I'm pleased to announce that @TroyAndFish and @mulia_jo's paper on dedifferentiation and ECM remodeling in regeneration is out today in @Nature_NPJ Regenerative Medicine. https://t.co/OLN4I3v4w6
@CSCIColumbia @ColumbiaGenDev #zebrafish

[Sabrina Carrella @CarrellaSabrina]

I’m #hiring. Know anyone who might be interested?
Share or contact me if you are interested.

[Nicola de Prisco @nicdepris]

@CrackaOfficial @_Drew_2_U @krassenstein No, not for giving away things, but because did not ask permit to nyc which could have helped with managing so many followers.

[Nicola de Prisco @nicdepris]

@ViralCarmichael Congrats!!! 🍾

[Oded Rechavi @OdedRechavi]

Basically a post doc

[Gennarino Lab @GennarinoLab]

@nicdepris presenting his work at the Embo Meeting in Croatia. Amazing talk!