UCSF Biochemistry

[UCSF Biochemistry @Ucsf_Biochem]

@ReiterLab @semilc Congratulations, @ReiterLab! Check out new tricks for old dogs: how the cell cycle machinery coordinates cell differentiation at https://t.co/KQaZzlirXw.

[UCSF Biochemistry @Ucsf_Biochem]

We are hiring! The department is looking for three people: someone to help with human resources, an executive assistant to the chair, and a postdoc administrator. Details:
https://t.co/kUvrZDx9gc
https://t.co/YQqrdwcqYq
https://t.co/tHr9DsRVOC

[UCSF Biochemistry @Ucsf_Biochem]

One more week to submit your application! Join us here in the Department of Biochemistry and Biophysics at UC San Francisco:
https://t.co/Yx2pqrbqwC

[UCSF Biochemistry @Ucsf_Biochem]

We will be celebrating the life of Christine Guthrie on October 28. All are welcome. Please register at: https://t.co/c2PJFur0tK

[UCSF Biochemistry @Ucsf_Biochem]

Come join us for a TT position at #UCSF Biochem! A great, dynamic group of supportive faculty and San Francisco is a plus. Deadline is Halloween!
https://t.co/Yx2pqrstyC

[Reiter Lab @ReiterLab]

Protocol:
1.Nasal swab into 100ul RNA shield on D2
2.RNeasy RNA isolation
3.iScript RT w/ AAACAGTTGCTGGTGCATGT
4.Phusion (touchdown from 65-62° 30” extension w/ TTTAACGCCACCAGATTTGC and CAGTTGCTGGTGCATGTAGAA)
5.Sequence w/ TGCTTGGAACAGGAAGAGAA and TGCATGTAGAAGTTCAAAAGAAAG

[UCSF Biochemistry @Ucsf_Biochem]

Sadly, our friend, colleague, inspiration and leader, Christine Guthrie, died Friday. She was a pioneering scientist, helped build our department, and was beloved. She discovered yeast snRNAs and brilliantly used suppressor screens to elucidate how splicing works. We miss her.

[ThePatrick&WatsonLabs @The_PW_Lab]

The whole RNA world owes SO much to Christine Guthrie. I will forever be thankful for what she taught me and be in awe of her strength and resilience. 1/4.

[UCSF Biochemistry @Ucsf_Biochem]

Happy birthday, @dsboothacosta! We all can't wait to learn what you discover next!

[UCSF Biochemistry @Ucsf_Biochem]

Great to have Dr. Jeeyun Chung, PhD presenting on “How cells deal with fat: Mechanisms of lipid
storage and mobilization” today at noon in Byers Hall!

[UCSF Biochemistry @Ucsf_Biochem]

Apply for a TT job with us in #UCSF Biochem! The deadline is looming, and I'd love for you to be part of this great, supportive, creative community!
https://t.co/PkOA7Utx6I

[UCSF Biochemistry @Ucsf_Biochem]

We are hiring this year! Speaking from personal experience, UCSF Biochemistry and CMP are parts of a wonderful and supportive community for launching a new lab. We are eager to learn about a broad diversity of science. Come join us! https://t.co/PkOA7Utx6I

[UCSF Biochemistry @Ucsf_Biochem]

Wonderful news of @Ucsf_Biochem's @dsboothacosta, and his newly minted Packard Fellowship. Packard Fellows are a community of extremely disparate areas of science, making for extensive cross-pollination.

[Packard Foundation @PackardFdn]

.@dsboothacosta’s research illuminates how genetic & environmental changes influenced animals’ origin. The @bioboothlab at @UCSF_Biochem develops genetic tools for a key group of marine #microeukaryotes (aka microscopic, nucleated & single-celled organisms). #PackardFellows

[UCSF Biochemistry @Ucsf_Biochem]

Wow! Wonderful new crew that the @NIH has recognized with New Innovator awards, including our own Vijay Ramani @vram142, Daniele Canzio and Dan Wagner @danwagnerlab at #UCSF. Congratulations, and I can't wait to watch the fascinating ways in which you build on this opportunities!

[UCSF Biochemistry @Ucsf_Biochem]

Hooray! Wonderful recognition of the pioneering work of #UCSF’s @DJuliusSF and also @ardemp! Heartiest congratulations, both! Understanding TRP channels is a fundamental advance in how cells sense their worlds and communicate to the rest of the organism. Thank your TRPs!

[The Nobel Prize @NobelPrize]

BREAKING NEWS:
The 2021 #NobelPrize in Physiology or Medicine has been awarded jointly to David Julius and Ardem Patapoutian “for their discoveries of receptors for temperature and touch.”

[UC San Francisco @UCSF]

Published today in @ScienceMagazine, UCSF’s Walter lab and collaborators describe how a stress sensor directs cells to make corrections when proteins get misfolded and threaten cellular health. https://t.co/dgimV9EUVD

[UCSF Biochemistry @Ucsf_Biochem]

We are hiring this year! Speaking from personal experience, UCSF Biochemistry and CMP are parts of a wonderful and supportive community for launching a new lab. We are eager to learn about a broad diversity of science. Come join us! https://t.co/PkOA7Utx6I

[Kira Poskanzer @KiraPoskanzer]

Our group https://t.co/18fd4Fcc0e is hiring at the postdoc, staff scientist, and technician levels to study physiology of astrocytes and neurons. We want to hear from people with a wide variety of backgrounds and expertise, including those who haven’t studied glia before. 1/2

[UCSF Biochemistry @Ucsf_Biochem]

Wonderful news this morning about our own Hani Goodarzi @genophoria! He's a recipient of a 2022 #Vilcek Foundation Prize recognizing important #immigrant contributions here in the US. I can't wait to find what other surprises RNA has in store for us!
https://t.co/GxwYyBgVYg

[UCSF Biochemistry @Ucsf_Biochem]

❤️ right back at'cha, @seemaychou! Science is big and benefits from a wide variety of approaches (and people!).

[seemay chou @seemaychou]

A great chair/mentor is someone who supports you enthusiastically as you grow, even if that means leaving ❤️

[UCSF Biochemistry @Ucsf_Biochem]

Oh, this is going to be an exciting endeavor, and a powerful accelerator of non-model organism biology. Exciting!

[seemay chou @seemaychou]

Let’s make this a reality ⁦@PracheeAC⁩ #arcadiascience https://t.co/B9Zq51obgd

[UCSF Biochemistry @Ucsf_Biochem]

An awesome profile of @UCSF's and @czbiohub's own Joe DeRisi in @nytimes:
https://t.co/9jhmbcEQYJ