VastDB

VastDB is a repository of quantitative profiles of alternative splicing events and GE data across different tissues and species. Developed at @CRGenomica

[VastDB @VastDB]

We have released a new batch of functional annotations (v11): 600 entries from previous publications investigating the function of AS events. This makes a total of 3637 entries directly from publications, 397 from CRISPR screens and 1511 from experimentally validated ELMs.

[VastDB @VastDB]

Cotyledon opening during seedling deetiolation is determined by ABA-mediated splicing regulation

https://t.co/zxnD4CG8Pe

[Inés Lucía Patop @inespatop]

This sounds like a dream!! Barcelona and Berlin with amazing scientists and great people. Having worked with both groups I would highly highly (yes twice :) recommend it.

[Manuel Irimia @mirimiam]

🐟Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @eLife🐟

A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @CRGenomica & @UPFbiomed

https://t.co/M8rt8jyWaI

Thread👇

[Manuel Irimia @mirimiam]

🚨🚨🚨
If you're a bioinformatician who loves:

🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing
🚀 Collaborating and travelling

Apply to work with us at the spectacular @BIMSB_MDC in Berlin + @UPFbiomed-@CRGenomica in Barcelona. Qs:https://t.co/ZikhH1zEGM

Please RT!🙏

[UPF Medicine and Life Sciences @UPFbiomed]

📢 We're hiring!
We are looking for two excellent early career candidates to join #MELISupf as Junior Group Leaders in Computational Biology, and in Quantitative Biology
More information and application links: https://t.co/uYvVzV9KLy
Deadline: 28 Jan 2025
#JobOffer

[Jose Lucas Lab @JJLucasLab]

Finally out https://t.co/NwSmunseCb the study (led by @xsalvatella1 & @RMendezLab) with the biophysical explanation for the profound effect of the microexon of CPEB4 as cause of autism, that we previously reported back in 2018
@ParrasAlbert @GeschwindLab @mirimiam @hervas_millan

[Manuel Irimia @mirimiam]

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais_espana! Congrats to the Mendez, @xsalvatella1 and @JJLucasLab labs for this amazing work!

https://t.co/55rVWmyB5H

[Manuel Irimia @mirimiam]

We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @EvoMG_Bcn at UPF-CRG with the @ViroUPF lab.

https://t.co/twRvBcvIBV

[ShorterLab @ShorterLab]

Circular RNAs trigger nonsense-mediated mRNA decay: https://t.co/OdtwqpBWoA

[Rosa Fernández @Rosamygale]

Come to the dark side! Join the #darkproteome team to work on plant functional annotation within our OSCARS
@HorizonEU
project FAIRFUN4Biodiversity. Great project, great advisor, great city and great team! 👇👇
@CsicLifehub

[Arnone Lab @ArnoneLab]

Thrilled to share this new work resulting from a great collaboration of my lab with the labs of @imaesomar and @veronica_hinman, started with the dear José Luis Gómez-Skarmeta many years ago. Take a look!
https://t.co/IAVjesBPt8

[Centre for Genomic Regulation (CRG) @CRGenomica]

Big🧬news this week: we have launched the first Joint Program on Evolutionary Medical Genomics. Spearheaded by @mirimiam, Barcelona researchers will study and exploit the vast genomic diversity of life on Earth to enhance precision medicine.
https://t.co/40FOsnjsfM

[Jose Lucas Lab @JJLucasLab]

Great collaboration with @lrdesviat and @AndresenBrage to find ways to modulate inclusion of a microexon (CPEB4 exon 4) involved in autism!
@sarapico7 @mirimiam @GeschwindLab @ParrasAlbert @RMendezLab @SENC_ @CBM_CSIC_UAM @CIBER_ISCIII

[Malgorzata Rogalska @MalgorzataRoga1]

🎉Excited to announce that our paper on the blueprint of the human spliceosome is now out in @ScienceMagazine ! A decade of work with Juan Valcárcel and the incredible team at @CRGenomica to uncover the intricate roles of this essential RNA machinery.https://t.co/azZ4aSlD3s

[The Blencowe Lab @ U of T @Blencowe_Lab]

Out now: Using highly sensitive luminescence splicing reporters, we screened ~95,000 small-molecule compounds for modulators of neuronal microexons, a class of highly conserved alternative splicing misregulated in #autism & #NeuroendocrineCancer. 1/4 https://t.co/o1vmQunLRn

[Itai Yanai @ItaiYanai]

Published today! We found that cancer cells adapting to drug treatments don't simply switch from a sensitive to resistant state; instead there's a ‘resistance continuum’ of resistant phenotypes with epigenetically reprogrammed states. 🧵⬇️
https://t.co/Jgx79K3i3a @Gustavo_SFranca

[EvoMG Program @EvoMG_Bcn]

🚨 We're excited to announce our Inaugural Symposium on Evolutionary Medical Genomics (EvoMG) at @the_prbb in Barcelona, November 20-22 2024.

👇Our great speakers and topics!

Further info: https://t.co/HJtpgctUG7

@CRGenomica @UPFbiomed @IBE_Barcelona

[Manuel Irimia @mirimiam]

Very excited to announce the inaugural symposium of our @EvoMG_Bcn Joint Program on Evolutionary Medical Genomics!

Join us in Barcelona on the 20th-22nd of November (no registration free).

Great speakers and cool and diverse topics!

@CRGenomica @UPFbiomed @IBE_Barcelona

[Manuel Irimia @mirimiam]

The peer-reviewed version of our study on the evolution of tissue-specific expression across vertebrates and insects is finally published in @NatureEcoEvo ! @FedeMantica @CRGenomica @UPFbiomed

https://t.co/PyaO9RBLhC

[Arnau Sebé Pedrós @ArnauSebe]

Job alert!
We offer two positions (Team leader & Bioinformatics developer) to work on the Biodiversity Cell Atlas database: unified pipelines, data curation, and cross-species integration. With @irenepapatheodo @RodericGuigo @ExpressionAtlas @emblebi

🗓️Apr-10
🔗Details below