Oscar Martinez

I am a pharmacist doing research to cure sarcoma @srgidibell and now also entrepreneur, founder of Aptadel therapeutics @aptadel. Also a runner

[Oscar Martinez @omt2007]

Marathons run:
1997 San Sebastian 2h52’
2000 Barcelona 2h38’
2003 Marine Corp’s DC 2h45’
2020 El Prat 3h17’
2021 Barcelona 3h08’
2022 UltraPirineu 8h00’
2023 Athens 3h28’
2024 San Sebastian Cancelled
2025 Rome 3h33’
2026 Edimburg 3h43’
Next Copenhagen 2027

[Oscar Martinez @omt2007]

@totcosta Peñarol

[Oscar Martinez @omt2007]

Marathons run:
1997 San Sebastian 2h52’
2000 Barcelona 2h38’
2003 Marine Corp’s DC 2h45’
2020 El Prat 3h17’
2021 Barcelona 3h08’
2022 UltraPirineu 8h00’
2023 Athens 3h28’
2024 San Sebastian Cancelled
2025 Rome 3h33’
2026 Edimburg 3h43’
Next….

[Contra el Cáncer Investigación @contracancerINV]

🔬 Impulsar innovación es acompañar la investigación hasta el paciente.

Llevamos más de 10 años apoyando al Dr. Òscar Martínez-Tirado @SRGIDIBELL en el @idibell_cat en una estrategia innovadora frente al Sarcoma De Ewing.

Más info 👇
https://t.co/uDrotvTtm0 💚

[diariARA @diariARA]

Aptadel Therapeutics capta 2 M€ per desenvolupar el seu fàrmac contra el sarcoma d'Ewing https://t.co/UICeysowPC

[Oscar Martinez @omt2007]

@nedgia Más de 48h sin servicio de gas en casa sin previo aviso por falta de una inspección concertada a la que nunca se presentaron. Llevo 3 dias llamando a atención al cliente y la respuesta es prioritario le llaman hoy. Todavia esperando…Donde denuncio @gencat ?

[Associació Contra el Càncer BARCELONA @ContraCancerBCN]

Ponència “Innovació: del laboratori al pacient” Participen: STAb Therapeutics, Belén Blanco; STAb Therapeutics, Elena Barba; IDIBELL, Òscar Martínez-Tirado; Aptadel Therapeutics, Gisela Llorente. La recerca es transforma en solucions reals per a les persones #contraelcancerbcn

[Associació Contra el Càncer BARCELONA @ContraCancerBCN]

60 ajudes. 13,11M€ el 2025. 68,62M€ en desenvolupament a Barcelona. La supervivència depèn de la recerca. Seguim! #contraelcancerbcn

[Nature Chemical Biology @nchembio]

A new paper reveals that adhesion GPCRs promote extracellular vesicle (EV) formation and EVs spread GPCRs into neighboring cells to activate G-protein signaling, providing a novel mechanism for cell-cell communication

https://t.co/QH1kcNDrIM

[Guillermo Montoya @g1_guillermo]

Esto es magnifico, pero un plan para aumentar el raquítico presupuesto actual sería de gran ayuda para todos los científicos

[Rodriguez-Perales Lab @MolCytogenLab]

In preclinical models of neuroblastoma, SCLC, and colorectal cancer, we observe reduced tumor growth, improved survival, and signs of ICD.
Link:https://t.co/yAqd90CBGJ
@CNIOStopCancer @BioInn_CIEMAT @SpringerNature @BioMedCentral

[Oscar Martinez @omt2007]

@AAytesLab Pues no se porque lo dices.....😅

[Simon Maechling @simonmaechling]

Now that everyone is an expert on curing pancreatic cancer in mice, not rats - I want to add some context that goes beyond the headline.
You will want to read this.

Cancer is cured in mice all the time.
Thousands of times. ~90% of those “cures” fail in humans.

Why?
Because mice are:
Genetically simpler.
Treated earlier.
Short-lived.
Not humans.

Mice are a filter - not a finish line.

Yes, this study matters. It comes from the Spanish National Cancer Research Centre.

Yes, it’s pancreatic cancer - one of the deadliest there is. Yes, full tumor regression is impressive.

But here’s what it actually means:
“This approach is now good enough to risk years, trials, and millions of euros on.”
Not:
“Cancer is solved.”

What happens next?
More animal work.
Toxicology.
Phase I (safety).
Phase II (maybe works).
Phase III (beats standard care?).

Maybe 8-10 years if everything goes right.

The real damage isn’t failed drugs.
It’s failed expectations.

Every “cured cancer in mice” headline trains the public to believe:
Cures are being hidden.
Progress should be fast.
Scientists are lying when reality hits.

That’s how trust erodes.

Bottom line:
This is how real cancer progress looks.
Messy. Slow. Risky. Incremental.

Not miracles.
Not conspiracies.
Just science - doing the hard work.

[Oscar Martinez @omt2007]

Oh my!

[Žiga Avsec @Avsecz]

AlphaGenome is out in @nature today along with model weights! 🧬

📄 Paper: https://t.co/1fHzSPiY1x
💻 Weights: https://t.co/z6JWLT4Mpv

Getting here wasn’t a straight path. We sat down @googledeepmind to discuss the story behind the model, paper & API: https://t.co/cT8CiXfnxQ

[IDIBELL @idibell_cat]

The Viladecans Association Against Cancer allocates the money raised in 2025 to research against colorectal cancer🙌🤍

Since 2016, the Association has collected +200,000€ for IDIBELL's research: a real driving force. Thank you very much!

👉https://t.co/n5VPsYZRk4

[Liz Connolly @DrLizConnolly]

🧬 Cell therapy in #sarcoma: what do we know so far?

In our review in @jitcancer we cover

✔️TCR-T, CAR-T, TIL, NK-cell approaches
✔️Early clinical studies
✔️Key biological & practical challenges, inc. the tumour microenvironment
✔️Emerging directions

🔗 https://t.co/q768GoVKo8

[Oscar Martinez @omt2007]

To end the year I’d like to share our last work, comments are welcome. Many thanks to all the magnificent researchers involved! https://t.co/7m3PQsgPsA

[Ensembl @ensembl]

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

[Oscar Martinez @omt2007]

@Pucurull Per molts anys Pucu!!! Ets un exemple a seguir!!